Incidental Mutation 'R7068:Mtmr12'
ID 548704
Institutional Source Beutler Lab
Gene Symbol Mtmr12
Ensembl Gene ENSMUSG00000039458
Gene Name myotubularin related protein 12
Synonyms Pip3ap, C730015A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 12205028-12274496 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to G at 12257670 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 278 (M278R)
Ref Sequence ENSEMBL: ENSMUSP00000041227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038172] [ENSMUST00000071993] [ENSMUST00000174160] [ENSMUST00000174418]
AlphaFold Q80TA6
Predicted Effect probably null
Transcript: ENSMUST00000038172
AA Change: M278R

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000041227
Gene: ENSMUSG00000039458
AA Change: M278R

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 7.6e-55 PFAM
Pfam:3-PAP 559 687 3.2e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071993
SMART Domains Protein: ENSMUSP00000071883
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Myotub-related 17 193 7.8e-53 PFAM
Pfam:3-PAP 249 380 8.8e-40 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000174160
AA Change: M278R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000134293
Gene: ENSMUSG00000039458
AA Change: M278R

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Pfam:Myotub-related 182 501 3.2e-55 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174418
SMART Domains Protein: ENSMUSP00000133285
Gene: ENSMUSG00000039458

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
low complexity region 33 42 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositide 3-kinase-derived membrane-anchored phosphatidylinositides, such as phosphatidylinositol 3-phosphate (PtdIns(3)P), regulate diverse cellular processes. The protein encoded by this gene functions as an adaptor subunit in a complex with an active PtdIns(3)P 3-phosphatase. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Mtmr12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01801:Mtmr12 APN 15 12269959 missense probably damaging 1.00
IGL02158:Mtmr12 APN 15 12237930 missense probably damaging 1.00
pius UTSW 15 12245011 missense probably damaging 1.00
R0281:Mtmr12 UTSW 15 12257706 nonsense probably null
R1739:Mtmr12 UTSW 15 12245019 missense probably benign 0.06
R1876:Mtmr12 UTSW 15 12257630 missense probably damaging 1.00
R2284:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R4301:Mtmr12 UTSW 15 12236020 missense possibly damaging 0.95
R4424:Mtmr12 UTSW 15 12230314 missense probably damaging 0.98
R4617:Mtmr12 UTSW 15 12270046 missense probably damaging 1.00
R5418:Mtmr12 UTSW 15 12269959 missense probably damaging 1.00
R6316:Mtmr12 UTSW 15 12236113 missense probably null 0.31
R6857:Mtmr12 UTSW 15 12263832 missense probably damaging 1.00
R7511:Mtmr12 UTSW 15 12265595 missense possibly damaging 0.94
R7515:Mtmr12 UTSW 15 12269951 missense probably damaging 1.00
R7607:Mtmr12 UTSW 15 12257708 nonsense probably null
R7709:Mtmr12 UTSW 15 12245011 missense probably damaging 1.00
R8217:Mtmr12 UTSW 15 12259640 missense possibly damaging 0.89
R8257:Mtmr12 UTSW 15 12259598 missense possibly damaging 0.89
R8398:Mtmr12 UTSW 15 12265609 missense probably damaging 1.00
R8778:Mtmr12 UTSW 15 12269920 missense probably benign 0.00
RF013:Mtmr12 UTSW 15 12261898 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAGCGAGTCTCACTGCCTAG -3'
(R):5'- AGTGAGTGTTACTCTCCGATTCC -3'

Sequencing Primer
(F):5'- AGTAAATGTTTTTCATCGTCTCTAGC -3'
(R):5'- TCTCCGATTCCTCCAACACAGAG -3'
Posted On 2019-05-13