Incidental Mutation 'R7068:Olfr206'
ID548708
Institutional Source Beutler Lab
Gene Symbol Olfr206
Ensembl Gene ENSMUSG00000066257
Gene Nameolfactory receptor 206
SynonymsMOR182-4, GA_x54KRFPKG5P-55560552-55559632
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59344675-59349246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59345204 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 166 (T166A)
Ref Sequence ENSEMBL: ENSMUSP00000146906 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084791] [ENSMUST00000207927]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084791
AA Change: T166A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081849
Gene: ENSMUSG00000066257
AA Change: T166A

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 6.2e-48 PFAM
Pfam:7TM_GPCR_Srsx 34 295 2.6e-5 PFAM
Pfam:7tm_1 40 289 3.7e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000207927
AA Change: T166A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Olfr206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01372:Olfr206 APN 16 59345161 missense probably damaging 0.97
IGL02106:Olfr206 APN 16 59345024 missense probably benign 0.00
IGL02839:Olfr206 APN 16 59345390 missense probably benign 0.01
IGL03010:Olfr206 APN 16 59344772 utr 3 prime probably benign
R1163:Olfr206 UTSW 16 59345062 missense probably damaging 0.99
R1507:Olfr206 UTSW 16 59345493 missense probably damaging 1.00
R1670:Olfr206 UTSW 16 59345427 missense possibly damaging 0.79
R2881:Olfr206 UTSW 16 59344852 missense probably damaging 1.00
R2925:Olfr206 UTSW 16 59345343 nonsense probably null
R4479:Olfr206 UTSW 16 59344867 missense probably damaging 0.99
R4891:Olfr206 UTSW 16 59345471 missense possibly damaging 0.87
R5085:Olfr206 UTSW 16 59345086 missense probably damaging 0.99
R5099:Olfr206 UTSW 16 59344903 missense probably benign 0.00
R5218:Olfr206 UTSW 16 59344907 missense probably benign
R6019:Olfr206 UTSW 16 59345435 missense possibly damaging 0.48
R6773:Olfr206 UTSW 16 59345216 missense probably damaging 1.00
R7173:Olfr206 UTSW 16 59345147 missense probably benign 0.00
R7192:Olfr206 UTSW 16 59345179 missense probably benign 0.44
R7485:Olfr206 UTSW 16 59345324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGCAGGTGAAGAAAGCTTTC -3'
(R):5'- CTACTGAAATTTTCCTTCTGGTAGCG -3'

Sequencing Primer
(F):5'- CAGGTGAAGAAAGCTTTCCTTCTGC -3'
(R):5'- CGATGGCCTATGACCGCTATGTAG -3'
Posted On2019-05-13