Incidental Mutation 'R7068:Smchd1'
ID 548715
Institutional Source Beutler Lab
Gene Symbol Smchd1
Ensembl Gene ENSMUSG00000024054
Gene Name SMC hinge domain containing 1
Synonyms 4931400A14Rik, MommeD1
MMRRC Submission
Accession Numbers
Essential gene? Probably essential (E-score: 0.769) question?
Stock # R7068 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 71344489-71475343 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 71387092 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 1219 (S1219R)
Ref Sequence ENSEMBL: ENSMUSP00000121835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127430]
AlphaFold Q6P5D8
Predicted Effect probably benign
Transcript: ENSMUST00000127430
AA Change: S1219R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: S1219R

DomainStartEndE-ValueType
Pfam:HATPase_c_3 139 299 6.8e-16 PFAM
low complexity region 451 457 N/A INTRINSIC
internal_repeat_1 859 1087 9.1e-5 PROSPERO
low complexity region 1185 1196 N/A INTRINSIC
internal_repeat_1 1205 1409 9.1e-5 PROSPERO
coiled coil region 1649 1680 N/A INTRINSIC
SMC_hinge 1721 1848 1.64e-15 SMART
low complexity region 1940 1954 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Ik T G 18: 36,755,465 F439V possibly damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Smchd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Smchd1 APN 17 71465673 splice site probably benign
IGL00529:Smchd1 APN 17 71394799 missense probably benign 0.30
IGL00642:Smchd1 APN 17 71390432 missense probably damaging 1.00
IGL00821:Smchd1 APN 17 71398623 missense possibly damaging 0.92
IGL01330:Smchd1 APN 17 71436788 missense probably benign
IGL01432:Smchd1 APN 17 71431290 missense probably damaging 1.00
IGL01473:Smchd1 APN 17 71389750 missense probably benign 0.00
IGL01705:Smchd1 APN 17 71381398 missense probably damaging 1.00
IGL01787:Smchd1 APN 17 71391418 missense probably damaging 0.99
IGL01814:Smchd1 APN 17 71378187 missense probably benign 0.01
IGL01976:Smchd1 APN 17 71394725 nonsense probably null
IGL01995:Smchd1 APN 17 71444020 missense probably damaging 0.98
IGL02090:Smchd1 APN 17 71431253 missense possibly damaging 0.86
IGL02302:Smchd1 APN 17 71358133 splice site probably benign
IGL02309:Smchd1 APN 17 71443903 missense probably benign 0.32
IGL02391:Smchd1 APN 17 71431259 missense probably null 1.00
IGL02515:Smchd1 APN 17 71440957 missense probably damaging 1.00
IGL02644:Smchd1 APN 17 71360021 splice site probably benign
IGL03081:Smchd1 APN 17 71360191 missense probably damaging 0.98
IGL03212:Smchd1 APN 17 71443891 missense probably damaging 0.99
IGL03236:Smchd1 APN 17 71391430 missense possibly damaging 0.88
IGL03297:Smchd1 APN 17 71349700 missense probably benign 0.01
Dry_tortugas UTSW 17 71440956 missense probably damaging 1.00
R0049:Smchd1 UTSW 17 71431236 missense probably benign 0.01
R0254:Smchd1 UTSW 17 71411891 missense probably benign 0.00
R0391:Smchd1 UTSW 17 71403154 missense probably damaging 1.00
R0403:Smchd1 UTSW 17 71394902 missense probably damaging 1.00
R0499:Smchd1 UTSW 17 71387088 missense probably benign
R0520:Smchd1 UTSW 17 71429543 missense possibly damaging 0.85
R0616:Smchd1 UTSW 17 71379574 missense probably benign 0.39
R1120:Smchd1 UTSW 17 71358146 nonsense probably null
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1469:Smchd1 UTSW 17 71349730 missense probably damaging 1.00
R1473:Smchd1 UTSW 17 71361837 splice site probably benign
R1484:Smchd1 UTSW 17 71378257 missense probably benign 0.31
R1501:Smchd1 UTSW 17 71365094 missense possibly damaging 0.54
R1718:Smchd1 UTSW 17 71448833 missense possibly damaging 0.46
R1765:Smchd1 UTSW 17 71400201 splice site probably benign
R1766:Smchd1 UTSW 17 71391379 missense probably damaging 0.99
R1803:Smchd1 UTSW 17 71387006 missense probably damaging 0.99
R1829:Smchd1 UTSW 17 71370337 missense probably damaging 1.00
R1850:Smchd1 UTSW 17 71389771 missense probably damaging 0.99
R1917:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1918:Smchd1 UTSW 17 71407237 missense possibly damaging 0.48
R1936:Smchd1 UTSW 17 71463791 missense probably damaging 1.00
R2024:Smchd1 UTSW 17 71370928 missense probably benign 0.15
R2147:Smchd1 UTSW 17 71398588 missense possibly damaging 0.93
R2180:Smchd1 UTSW 17 71463799 missense probably benign 0.23
R2398:Smchd1 UTSW 17 71360141 missense probably damaging 1.00
R2398:Smchd1 UTSW 17 71426436 splice site probably benign
R2935:Smchd1 UTSW 17 71411905 missense probably damaging 1.00
R3000:Smchd1 UTSW 17 71363038 missense probably benign 0.00
R3021:Smchd1 UTSW 17 71387098 missense possibly damaging 0.75
R3808:Smchd1 UTSW 17 71429541 missense probably damaging 1.00
R4323:Smchd1 UTSW 17 71428275 missense probably benign 0.00
R4486:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4487:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4488:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4489:Smchd1 UTSW 17 71407235 missense probably benign 0.02
R4723:Smchd1 UTSW 17 71436747 nonsense probably null
R4751:Smchd1 UTSW 17 71391468 missense probably benign 0.01
R4798:Smchd1 UTSW 17 71360053 nonsense probably null
R4814:Smchd1 UTSW 17 71411768 critical splice donor site probably null
R4882:Smchd1 UTSW 17 71358239 intron probably benign
R5088:Smchd1 UTSW 17 71431348 missense possibly damaging 0.86
R5589:Smchd1 UTSW 17 71440961 missense probably damaging 1.00
R5618:Smchd1 UTSW 17 71455727 missense probably damaging 1.00
R5839:Smchd1 UTSW 17 71394862 missense probably damaging 0.98
R5994:Smchd1 UTSW 17 71365409 missense possibly damaging 0.89
R6009:Smchd1 UTSW 17 71440956 missense probably damaging 1.00
R6042:Smchd1 UTSW 17 71377057 nonsense probably null
R6082:Smchd1 UTSW 17 71349719 missense probably benign 0.09
R6126:Smchd1 UTSW 17 71370285 missense probably damaging 1.00
R6294:Smchd1 UTSW 17 71370927 missense probably benign 0.13
R6788:Smchd1 UTSW 17 71475101 missense probably benign 0.02
R6853:Smchd1 UTSW 17 71436743 missense probably damaging 1.00
R6875:Smchd1 UTSW 17 71353506 missense probably damaging 1.00
R7026:Smchd1 UTSW 17 71349667 missense probably benign
R7045:Smchd1 UTSW 17 71415044 missense probably benign 0.22
R7085:Smchd1 UTSW 17 71365219 splice site probably null
R7089:Smchd1 UTSW 17 71361960 missense probably benign 0.00
R7145:Smchd1 UTSW 17 71378207 missense probably benign
R7158:Smchd1 UTSW 17 71400150 missense probably damaging 0.99
R7180:Smchd1 UTSW 17 71394823 missense probably damaging 0.99
R7183:Smchd1 UTSW 17 71353516 missense probably benign 0.00
R7214:Smchd1 UTSW 17 71345364 missense probably benign 0.15
R7414:Smchd1 UTSW 17 71475079 missense probably damaging 0.99
R7512:Smchd1 UTSW 17 71381369 missense possibly damaging 0.51
R7631:Smchd1 UTSW 17 71398689 missense probably benign 0.10
R7641:Smchd1 UTSW 17 71390479 missense probably benign 0.00
R7709:Smchd1 UTSW 17 71358198 missense probably damaging 1.00
R7768:Smchd1 UTSW 17 71411911 missense probably damaging 1.00
R7789:Smchd1 UTSW 17 71475301 start gained probably benign
R7898:Smchd1 UTSW 17 71377818 splice site probably null
R7965:Smchd1 UTSW 17 71455626 missense possibly damaging 0.65
R8177:Smchd1 UTSW 17 71390453 missense probably benign 0.28
R8359:Smchd1 UTSW 17 71431243 missense probably damaging 0.99
R8370:Smchd1 UTSW 17 71394913 missense probably benign 0.22
R8426:Smchd1 UTSW 17 71448603 missense probably damaging 1.00
R8443:Smchd1 UTSW 17 71407249 missense probably benign 0.18
R8948:Smchd1 UTSW 17 71436772 missense probably damaging 1.00
R8954:Smchd1 UTSW 17 71448757 missense probably damaging 1.00
R9041:Smchd1 UTSW 17 71394715 critical splice donor site probably null
R9054:Smchd1 UTSW 17 71363022 nonsense probably null
R9141:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9169:Smchd1 UTSW 17 71415664 missense probably damaging 1.00
R9231:Smchd1 UTSW 17 71365089 missense probably benign 0.05
R9368:Smchd1 UTSW 17 71387076 missense probably damaging 1.00
R9374:Smchd1 UTSW 17 71411848 missense possibly damaging 0.61
R9416:Smchd1 UTSW 17 71394796 missense probably benign 0.27
R9426:Smchd1 UTSW 17 71365130 missense probably benign 0.00
R9491:Smchd1 UTSW 17 71360025 critical splice donor site probably null
R9511:Smchd1 UTSW 17 71443904 missense possibly damaging 0.65
R9591:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
R9593:Smchd1 UTSW 17 71394833 missense probably damaging 1.00
Z1176:Smchd1 UTSW 17 71361841 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- TAGGGAGCCTGCATCTCTAG -3'
(R):5'- CTTTAGATTCCCTGCCACTGAAAG -3'

Sequencing Primer
(F):5'- TCTAGCTCTTCCCAGGGAGACAG -3'
(R):5'- GTTCAGTCTGTTACCCCA -3'
Posted On 2019-05-13