Incidental Mutation 'R7068:Ik'
ID548716
Institutional Source Beutler Lab
Gene Symbol Ik
Ensembl Gene ENSMUSG00000024474
Gene NameIK cytokine
SynonymsMuRED
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R7068 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location36744656-36757639 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36755465 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Valine at position 439 (F439V)
Ref Sequence ENSEMBL: ENSMUSP00000007042 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007042] [ENSMUST00000049323]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007042
AA Change: F439V

PolyPhen 2 Score 0.568 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007042
Gene: ENSMUSG00000024474
AA Change: F439V

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Pfam:RED_N 76 302 1.6e-105 PFAM
low complexity region 334 380 N/A INTRINSIC
Pfam:RED_C 445 554 1.1e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049323
SMART Domains Protein: ENSMUSP00000039010
Gene: ENSMUSG00000042660

DomainStartEndE-ValueType
low complexity region 11 22 N/A INTRINSIC
WD40 31 67 4.6e0 SMART
WD40 74 113 1.12e-2 SMART
WD40 116 155 2.4e-2 SMART
WD40 158 197 2.76e-2 SMART
WD40 202 239 1.72e0 SMART
WD40 284 324 2.01e-4 SMART
low complexity region 380 388 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified by its RED repeat, a stretch of repeated arginine, glutamic acid and aspartic acid residues. The protein localizes to discrete dots within the nucleus, excluding the nucleolus. Its function is unknown. This gene maps to chromosome 5; however, a pseudogene may exist on chromosome 2. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,622,580 H24R probably benign Het
Ago2 A T 15: 73,146,450 F46L probably damaging Het
Amd1 A G 10: 40,290,512 F123L probably benign Het
Arhgef10 T C 8: 14,958,639 F546L probably damaging Het
Asic2 G A 11: 81,152,255 H71Y probably benign Het
Asphd1 A G 7: 126,948,678 V151A probably benign Het
Best3 T C 10: 116,988,638 V3A probably damaging Het
C4b A G 17: 34,733,477 L1196P probably damaging Het
Cd22 A G 7: 30,878,079 V3A probably benign Het
Cdkl3 T C 11: 52,011,327 probably null Het
Clcnka A T 4: 141,387,110 V631E probably damaging Het
Cmya5 A G 13: 93,092,697 V1961A possibly damaging Het
Dnah14 A G 1: 181,769,790 E3559G probably benign Het
Emsy A T 7: 98,610,761 D39E probably benign Het
Fam126a A G 5: 23,964,795 S519P possibly damaging Het
Fbxl16 G T 17: 25,819,511 V477F possibly damaging Het
Flt1 A T 5: 147,673,634 I393N probably damaging Het
Gabra4 A T 5: 71,572,059 N433K probably benign Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Ghsr T A 3: 27,371,837 V14D probably benign Het
Glb1l A G 1: 75,202,737 Y183H probably damaging Het
Ighv3-4 T C 12: 114,253,654 T106A probably damaging Het
Itih5 T C 2: 10,249,304 S789P probably damaging Het
Kcnj8 T C 6: 142,566,239 D214G probably damaging Het
Kdm5a C A 6: 120,430,215 H1464N probably benign Het
Klb A T 5: 65,379,340 Y671F probably damaging Het
Kremen2 C A 17: 23,741,885 R421L possibly damaging Het
Mroh9 T A 1: 163,039,181 D662V probably damaging Het
Mtmr12 T G 15: 12,257,670 M278R probably null Het
Ndufa8 T C 2: 36,044,435 M44V possibly damaging Het
Nedd4l A T 18: 65,205,651 R695S probably damaging Het
Nuf2 G A 1: 169,522,419 P97S probably damaging Het
Olfr1018 T C 2: 85,823,052 V27A probably benign Het
Olfr206 T C 16: 59,345,204 T166A possibly damaging Het
Olfr310 A C 7: 86,269,537 L84R probably damaging Het
P4ha2 A G 11: 54,110,994 T33A probably benign Het
Parp1 A G 1: 180,588,668 H544R probably damaging Het
Plec A G 15: 76,177,769 L2678P probably damaging Het
Rad1 T A 15: 10,490,293 Y85* probably null Het
Sema6d A G 2: 124,657,821 I309V probably benign Het
Skint2 T C 4: 112,624,351 V137A probably damaging Het
Slc23a3 T C 1: 75,133,233 N130S probably benign Het
Slc35f1 T C 10: 53,062,500 F176S probably damaging Het
Slc44a2 T A 9: 21,320,848 Y10N probably benign Het
Smarcc1 A G 9: 110,185,884 T506A probably damaging Het
Smchd1 A T 17: 71,387,092 S1219R probably benign Het
Smco1 A G 16: 32,274,111 N200S probably benign Het
Srcap A G 7: 127,541,943 T1571A probably benign Het
Strip2 C T 6: 29,932,208 T459I probably benign Het
Tarbp1 C T 8: 126,427,034 A1560T probably damaging Het
Tcl1b1 T A 12: 105,159,693 probably benign Het
Tdrd5 T C 1: 156,284,271 E436G probably damaging Het
Trim31 T A 17: 36,898,516 C55S probably damaging Het
Tsr1 G T 11: 74,903,919 E467* probably null Het
Tulp4 T A 17: 6,185,289 D178E probably damaging Het
Vmn1r30 A G 6: 58,435,010 V279A possibly damaging Het
Vmn2r98 A G 17: 19,065,313 R132G probably benign Het
Other mutations in Ik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00536:Ik APN 18 36756868 nonsense probably null
IGL01409:Ik APN 18 36756921 missense probably damaging 1.00
IGL01636:Ik APN 18 36751201 missense possibly damaging 0.63
IGL02282:Ik APN 18 36745644 missense probably damaging 0.99
IGL02422:Ik APN 18 36753260 critical splice acceptor site probably null
IGL03263:Ik APN 18 36748646 missense probably damaging 0.98
IGL03356:Ik APN 18 36756604 missense probably damaging 1.00
R0675:Ik UTSW 18 36747333 unclassified probably benign
R1778:Ik UTSW 18 36756818 unclassified probably benign
R4060:Ik UTSW 18 36748890 missense probably damaging 0.96
R4606:Ik UTSW 18 36753555 missense possibly damaging 0.68
R4684:Ik UTSW 18 36752414 missense probably damaging 1.00
R4819:Ik UTSW 18 36753257 splice site probably null
R4978:Ik UTSW 18 36747415 missense possibly damaging 0.54
R5256:Ik UTSW 18 36748873 missense probably benign 0.00
R5751:Ik UTSW 18 36753513 missense probably benign 0.07
R5966:Ik UTSW 18 36755478 missense possibly damaging 0.50
R6378:Ik UTSW 18 36757288 missense probably damaging 1.00
R6952:Ik UTSW 18 36753560 missense probably damaging 1.00
R7143:Ik UTSW 18 36751177 missense probably damaging 1.00
R7242:Ik UTSW 18 36748222 missense probably null 1.00
Z1088:Ik UTSW 18 36744782 nonsense probably null
Z1176:Ik UTSW 18 36753515 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GGTATTTATCAACCAGAGAACCAG -3'
(R):5'- TACAGCCATGTCATCCATCC -3'

Sequencing Primer
(F):5'- GAACCAGTTCAGGCTTACAGCTG -3'
(R):5'- GCCATGTCATCCATCCTAAAGAG -3'
Posted On2019-05-13