Incidental Mutation 'R7069:Plxna2'
ID 548721
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms 2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 194618218-194816869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 194793904 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 1144 (T1144K)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027952
AA Change: T1144K

PolyPhen 2 Score 0.506 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: T1144K

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,901 F97Y probably damaging Het
4932415D10Rik G A 10: 82,289,943 T2411I probably damaging Het
Aasdh T A 5: 76,876,356 I991L probably benign Het
Actg2 C A 6: 83,520,763 G96V probably damaging Het
Adh5 T A 3: 138,451,051 L166* probably null Het
Akap13 A G 7: 75,610,262 D75G probably benign Het
Ank2 T C 3: 126,946,298 probably benign Het
Arfgap1 T A 2: 180,974,120 D197E probably benign Het
Aste1 T C 9: 105,396,707 probably null Het
Atp8b2 T A 3: 89,954,571 N78I probably damaging Het
Btbd11 C A 10: 85,387,656 R110S unknown Het
Cacna2d3 T A 14: 28,969,303 probably benign Het
Chrd T A 16: 20,739,433 W809R probably damaging Het
Col2a1 C T 15: 97,998,588 G60D unknown Het
Coro7 T A 16: 4,679,611 M1L probably damaging Het
Dhx40 T C 11: 86,797,743 I285V probably benign Het
Dopey1 T C 9: 86,550,169 probably null Het
Enox1 A T 14: 77,611,324 R358S probably damaging Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Fam196b T A 11: 34,402,677 C240S possibly damaging Het
Fam221a A C 6: 49,378,498 Q178P probably damaging Het
Fcho1 A C 8: 71,710,497 probably null Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gal3st2b A T 1: 93,940,619 N189Y possibly damaging Het
Ghr T A 15: 3,320,484 D404V probably damaging Het
Glis3 A T 19: 28,531,519 V355D probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm21671 A T 5: 25,949,844 S253T possibly damaging Het
Gpr12 A C 5: 146,583,539 V32G possibly damaging Het
Gspt1 T A 16: 11,222,661 L593F probably damaging Het
H2-Q7 A T 17: 35,440,031 T153S probably damaging Het
Hars2 A G 18: 36,787,956 I194V probably damaging Het
Hdac9 T A 12: 34,429,549 T202S possibly damaging Het
Hoxd13 T C 2: 74,669,024 Y239H probably damaging Het
Insm2 C T 12: 55,599,836 Q122* probably null Het
Ip6k1 T A 9: 108,045,452 probably null Het
Ippk T C 13: 49,461,743 V534A probably damaging Het
Itch T G 2: 155,209,994 F611C probably damaging Het
Itga1 A T 13: 114,968,240 N1083K probably damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kif18a T C 2: 109,295,002 S255P probably damaging Het
Klhl24 C G 16: 20,107,481 T253R probably benign Het
Krt81 T A 15: 101,460,728 T307S possibly damaging Het
Lbr A T 1: 181,828,789 W265R probably damaging Het
Lgals3bp T C 11: 118,393,173 T527A probably benign Het
Lzts1 A C 8: 69,140,745 V70G probably damaging Het
Map3k6 C T 4: 133,251,712 P1154S probably benign Het
Masp1 T C 16: 23,452,455 D681G probably benign Het
Mdga2 T C 12: 66,486,752 N948D probably benign Het
Mettl4 A T 17: 94,733,633 F364L probably damaging Het
Mosmo T C 7: 120,677,832 I23T probably benign Het
Mtg1 G A 7: 140,143,744 V96I probably benign Het
Myh11 T A 16: 14,218,939 R966S possibly damaging Het
Ncapg2 A G 12: 116,424,717 probably null Het
Nid1 G A 13: 13,508,768 V1144I probably benign Het
Olfr1250 T C 2: 89,656,566 I292V probably benign Het
Olfr544 C A 7: 102,484,772 C116F possibly damaging Het
Olfr622 A T 7: 103,639,960 M60K probably damaging Het
Oscar T G 7: 3,611,239 Y167S probably damaging Het
Pa2g4 T C 10: 128,560,690 T200A probably benign Het
Pcdh7 A G 5: 57,719,784 D227G probably benign Het
Plce1 G A 19: 38,758,940 G1702R probably damaging Het
Prl8a8 G A 13: 27,511,467 T99I probably benign Het
Prr29 C A 11: 106,376,259 H83Q probably damaging Het
Raly T A 2: 154,859,744 I108N possibly damaging Het
Ranbp9 A T 13: 43,419,622 S475R probably benign Het
Rogdi C A 16: 5,013,498 probably benign Het
Rorc C T 3: 94,372,907 Q6* probably null Het
Sacs T C 14: 61,212,496 L3997S probably damaging Het
Scn2a A T 2: 65,764,606 Y1933F probably benign Het
Sik3 T C 9: 46,210,743 L898P probably damaging Het
Sipa1l1 A G 12: 82,341,406 I135M probably damaging Het
Slc26a3 C A 12: 31,450,935 Q224K probably damaging Het
Sobp G T 10: 43,021,440 N716K probably benign Het
Spata16 A G 3: 26,927,334 D513G probably damaging Het
Stac T C 9: 111,572,326 R351G possibly damaging Het
Tecta T A 9: 42,394,941 T64S probably benign Het
Tert G A 13: 73,628,410 V427M probably damaging Het
Tex15 G A 8: 33,570,720 M333I probably benign Het
Tmbim4 A T 10: 120,220,759 Q72L probably benign Het
Trav9n-4 T C 14: 53,294,799 S37P probably benign Het
Trpv5 A T 6: 41,675,960 M93K possibly damaging Het
Ulk4 T C 9: 121,258,810 E272G probably benign Het
Ulk4 T C 9: 121,266,517 T79A probably benign Het
Upb1 A G 10: 75,412,768 N41D probably benign Het
Wls A T 3: 159,934,329 Y532F probably damaging Het
Zdhhc5 G A 2: 84,715,011 probably benign Het
Zfp109 T C 7: 24,229,360 D216G probably benign Het
Zfp473 G A 7: 44,732,374 A845V probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194790175 missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 splice site probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7288:Plxna2 UTSW 1 194796919 missense probably damaging 1.00
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
R7959:Plxna2 UTSW 1 194793864 frame shift probably null
R7959:Plxna2 UTSW 1 194810962 missense probably damaging 1.00
R7960:Plxna2 UTSW 1 194793864 frame shift probably null
R8261:Plxna2 UTSW 1 194749416 missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194790175 missense probably benign 0.01
R8463:Plxna2 UTSW 1 194644046 missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194793958 missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194796935 missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194788909 missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194793889 missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194788828 missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194749416 missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194644422 missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194644384 missense probably benign 0.05
R9484:Plxna2 UTSW 1 194644894 missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- ACCAGGTGTTCAGGTTTGAATG -3'
(R):5'- GGGTACAACAAGACTCCTGTG -3'

Sequencing Primer
(F):5'- CCTTAGGTATGCACAGTGGTAAAC -3'
(R):5'- GTATTAGCATCTAGAGATCTGGCC -3'
Posted On 2019-05-13