Incidental Mutation 'R7069:Scn2a'
ID 548722
Institutional Source Beutler Lab
Gene Symbol Scn2a
Ensembl Gene ENSMUSG00000075318
Gene Name sodium channel, voltage-gated, type II, alpha
Synonyms A230052E19Rik, Nav1.2, Scn2a1
MMRRC Submission 045165-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 65451115-65597791 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 65594950 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 1933 (Y1933F)
Ref Sequence ENSEMBL: ENSMUSP00000143882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000200829]
AlphaFold B1AWN6
Predicted Effect probably benign
Transcript: ENSMUST00000028377
AA Change: Y1933F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: Y1933F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 2.2e-81 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 9.6e-83 PFAM
Pfam:Ion_trans 759 994 3.6e-57 PFAM
Pfam:Na_trans_assoc 998 1204 1.7e-63 PFAM
Pfam:Ion_trans 1208 1484 3.3e-66 PFAM
Pfam:Ion_trans 1531 1788 2.8e-57 PFAM
Pfam:PKD_channel 1627 1782 8.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100067
AA Change: Y1933F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: Y1933F

DomainStartEndE-ValueType
Pfam:Ion_trans 157 424 3.3e-75 PFAM
low complexity region 433 448 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
Pfam:DUF3451 488 711 2.6e-66 PFAM
Pfam:Ion_trans 794 983 1.1e-47 PFAM
Pfam:Na_trans_assoc 998 1219 3.5e-77 PFAM
Pfam:Ion_trans 1245 1473 4.4e-55 PFAM
PDB:1BYY|A 1475 1527 3e-31 PDB
Pfam:Ion_trans 1566 1776 2.4e-52 PFAM
Pfam:PKD_channel 1628 1783 3.6e-7 PFAM
IQ 1905 1927 3.59e-3 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200829
AA Change: Y1933F

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: Y1933F

DomainStartEndE-ValueType
Pfam:Ion_trans 128 436 1.2e-79 PFAM
low complexity region 450 471 N/A INTRINSIC
Pfam:Na_trans_cytopl 505 710 7.1e-80 PFAM
Pfam:Ion_trans 759 994 2.1e-55 PFAM
Pfam:Na_trans_assoc 998 1204 8e-61 PFAM
Pfam:Ion_trans 1208 1484 1.9e-64 PFAM
Pfam:Ion_trans 1531 1788 1.6e-55 PFAM
Pfam:PKD_channel 1627 1782 1.2e-4 PFAM
IQ 1905 1927 1.8e-5 SMART
low complexity region 1967 1975 N/A INTRINSIC
low complexity region 1981 2000 N/A INTRINSIC
Meta Mutation Damage Score 0.0595 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 77,024,203 (GRCm39) I991L probably benign Het
Abtb3 C A 10: 85,223,520 (GRCm39) R110S unknown Het
Actg2 C A 6: 83,497,745 (GRCm39) G96V probably damaging Het
Adh5 T A 3: 138,156,812 (GRCm39) L166* probably null Het
Akap13 A G 7: 75,260,010 (GRCm39) D75G probably benign Het
Ank2 T C 3: 126,739,947 (GRCm39) probably benign Het
Arfgap1 T A 2: 180,615,913 (GRCm39) D197E probably benign Het
Aste1 T C 9: 105,273,906 (GRCm39) probably null Het
Atp8b2 T A 3: 89,861,878 (GRCm39) N78I probably damaging Het
Cacna2d3 T A 14: 28,691,260 (GRCm39) probably benign Het
Chrd T A 16: 20,558,183 (GRCm39) W809R probably damaging Het
Col2a1 C T 15: 97,896,469 (GRCm39) G60D unknown Het
Coro7 T A 16: 4,497,475 (GRCm39) M1L probably damaging Het
Cracdl A T 1: 37,670,982 (GRCm39) F97Y probably damaging Het
Dhx40 T C 11: 86,688,569 (GRCm39) I285V probably benign Het
Dop1a T C 9: 86,432,222 (GRCm39) probably null Het
Enox1 A T 14: 77,848,764 (GRCm39) R358S probably damaging Het
Ep400 A G 5: 110,815,990 (GRCm39) V2724A probably damaging Het
Fam221a A C 6: 49,355,432 (GRCm39) Q178P probably damaging Het
Fcho1 A C 8: 72,163,141 (GRCm39) probably null Het
Fndc1 A T 17: 7,988,567 (GRCm39) V1165D unknown Het
Gal3st2b A T 1: 93,868,341 (GRCm39) N189Y possibly damaging Het
Ghr T A 15: 3,349,966 (GRCm39) D404V probably damaging Het
Glis3 A T 19: 28,508,919 (GRCm39) V355D probably damaging Het
Gpr12 A C 5: 146,520,349 (GRCm39) V32G possibly damaging Het
Gspt1 T A 16: 11,040,525 (GRCm39) L593F probably damaging Het
H2-Q7 A T 17: 35,659,007 (GRCm39) T153S probably damaging Het
Hars2 A G 18: 36,921,009 (GRCm39) I194V probably damaging Het
Hdac9 T A 12: 34,479,548 (GRCm39) T202S possibly damaging Het
Hoxd13 T C 2: 74,499,368 (GRCm39) Y239H probably damaging Het
Insm2 C T 12: 55,646,621 (GRCm39) Q122* probably null Het
Insyn2b T A 11: 34,352,677 (GRCm39) C240S possibly damaging Het
Ip6k1 T A 9: 107,922,651 (GRCm39) probably null Het
Ippk T C 13: 49,615,219 (GRCm39) V534A probably damaging Het
Itch T G 2: 155,051,914 (GRCm39) F611C probably damaging Het
Itga1 A T 13: 115,104,776 (GRCm39) N1083K probably damaging Het
Itgae A C 11: 73,006,969 (GRCm39) D405A probably damaging Het
Kif18a T C 2: 109,125,347 (GRCm39) S255P probably damaging Het
Klhl24 C G 16: 19,926,231 (GRCm39) T253R probably benign Het
Krt81 T A 15: 101,358,609 (GRCm39) T307S possibly damaging Het
Lbr A T 1: 181,656,354 (GRCm39) W265R probably damaging Het
Lgals3bp T C 11: 118,283,999 (GRCm39) T527A probably benign Het
Lzts1 A C 8: 69,593,397 (GRCm39) V70G probably damaging Het
Map3k6 C T 4: 132,979,023 (GRCm39) P1154S probably benign Het
Masp1 T C 16: 23,271,205 (GRCm39) D681G probably benign Het
Mdga2 T C 12: 66,533,526 (GRCm39) N948D probably benign Het
Mettl4 A T 17: 95,041,061 (GRCm39) F364L probably damaging Het
Mosmo T C 7: 120,277,055 (GRCm39) I23T probably benign Het
Mtg1 G A 7: 139,723,657 (GRCm39) V96I probably benign Het
Myh11 T A 16: 14,036,803 (GRCm39) R966S possibly damaging Het
Ncapg2 A G 12: 116,388,337 (GRCm39) probably null Het
Nid1 G A 13: 13,683,353 (GRCm39) V1144I probably benign Het
Or4a77 T C 2: 89,486,910 (GRCm39) I292V probably benign Het
Or52a33 A T 7: 103,289,167 (GRCm39) M60K probably damaging Het
Or55b4 C A 7: 102,133,979 (GRCm39) C116F possibly damaging Het
Oscar T G 7: 3,614,238 (GRCm39) Y167S probably damaging Het
Pa2g4 T C 10: 128,396,559 (GRCm39) T200A probably benign Het
Pcdh7 A G 5: 57,877,126 (GRCm39) D227G probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Plce1 G A 19: 38,747,384 (GRCm39) G1702R probably damaging Het
Plxna2 C A 1: 194,476,212 (GRCm39) T1144K possibly damaging Het
Prl8a8 G A 13: 27,695,450 (GRCm39) T99I probably benign Het
Prr29 C A 11: 106,267,085 (GRCm39) H83Q probably damaging Het
Raly T A 2: 154,701,664 (GRCm39) I108N possibly damaging Het
Ranbp9 A T 13: 43,573,098 (GRCm39) S475R probably benign Het
Rogdi C A 16: 4,831,362 (GRCm39) probably benign Het
Rorc C T 3: 94,280,214 (GRCm39) Q6* probably null Het
Sacs T C 14: 61,449,945 (GRCm39) L3997S probably damaging Het
Sik3 T C 9: 46,122,041 (GRCm39) L898P probably damaging Het
Sipa1l1 A G 12: 82,388,180 (GRCm39) I135M probably damaging Het
Slc26a3 C A 12: 31,500,934 (GRCm39) Q224K probably damaging Het
Sobp G T 10: 42,897,436 (GRCm39) N716K probably benign Het
Spata16 A G 3: 26,981,483 (GRCm39) D513G probably damaging Het
Spata31h1 G A 10: 82,125,777 (GRCm39) T2411I probably damaging Het
Speer4a3 A T 5: 26,154,842 (GRCm39) S253T possibly damaging Het
Stac T C 9: 111,401,394 (GRCm39) R351G possibly damaging Het
Tecta T A 9: 42,306,237 (GRCm39) T64S probably benign Het
Tert G A 13: 73,776,529 (GRCm39) V427M probably damaging Het
Tex15 G A 8: 34,060,748 (GRCm39) M333I probably benign Het
Tmbim4 A T 10: 120,056,664 (GRCm39) Q72L probably benign Het
Trav9n-4 T C 14: 53,532,256 (GRCm39) S37P probably benign Het
Trpv5 A T 6: 41,652,894 (GRCm39) M93K possibly damaging Het
Ulk4 T C 9: 121,087,876 (GRCm39) E272G probably benign Het
Ulk4 T C 9: 121,095,583 (GRCm39) T79A probably benign Het
Upb1 A G 10: 75,248,602 (GRCm39) N41D probably benign Het
Wls A T 3: 159,639,965 (GRCm39) Y532F probably damaging Het
Zdhhc5 G A 2: 84,545,355 (GRCm39) probably benign Het
Zfp109 T C 7: 23,928,785 (GRCm39) D216G probably benign Het
Zfp473 G A 7: 44,381,798 (GRCm39) A845V probably damaging Het
Other mutations in Scn2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Scn2a APN 2 65,594,784 (GRCm39) missense probably benign
IGL00159:Scn2a APN 2 65,573,434 (GRCm39) missense probably damaging 1.00
IGL00418:Scn2a APN 2 65,594,866 (GRCm39) missense probably benign 0.43
IGL00753:Scn2a APN 2 65,514,207 (GRCm39) missense possibly damaging 0.66
IGL00770:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00774:Scn2a APN 2 65,566,197 (GRCm39) missense probably damaging 1.00
IGL00847:Scn2a APN 2 65,501,078 (GRCm39) missense probably damaging 1.00
IGL01155:Scn2a APN 2 65,548,092 (GRCm39) missense probably damaging 1.00
IGL01329:Scn2a APN 2 65,547,852 (GRCm39) missense probably benign 0.05
IGL01537:Scn2a APN 2 65,546,219 (GRCm39) missense probably benign 0.00
IGL01672:Scn2a APN 2 65,582,278 (GRCm39) missense probably damaging 1.00
IGL01958:Scn2a APN 2 65,532,173 (GRCm39) missense probably damaging 1.00
IGL02028:Scn2a APN 2 65,594,002 (GRCm39) missense probably damaging 0.96
IGL02142:Scn2a APN 2 65,546,182 (GRCm39) missense probably damaging 1.00
IGL02160:Scn2a APN 2 65,560,460 (GRCm39) missense probably damaging 1.00
IGL02183:Scn2a APN 2 65,501,947 (GRCm39) missense probably benign 0.20
IGL02341:Scn2a APN 2 65,518,721 (GRCm39) missense probably damaging 1.00
IGL02504:Scn2a APN 2 65,514,228 (GRCm39) missense probably benign 0.02
IGL02530:Scn2a APN 2 65,560,522 (GRCm39) missense probably damaging 0.99
IGL02621:Scn2a APN 2 65,579,223 (GRCm39) splice site probably benign
IGL02652:Scn2a APN 2 65,532,382 (GRCm39) missense possibly damaging 0.82
IGL02966:Scn2a APN 2 65,532,188 (GRCm39) missense possibly damaging 0.93
IGL03188:Scn2a APN 2 65,501,997 (GRCm39) missense probably damaging 0.99
IGL03329:Scn2a APN 2 65,594,973 (GRCm39) missense probably benign
IGL03336:Scn2a APN 2 65,519,088 (GRCm39) missense probably damaging 1.00
IGL03391:Scn2a APN 2 65,594,557 (GRCm39) missense probably damaging 1.00
PIT4280001:Scn2a UTSW 2 65,546,074 (GRCm39) missense probably damaging 1.00
PIT4362001:Scn2a UTSW 2 65,514,182 (GRCm39) missense probably benign 0.09
PIT4403001:Scn2a UTSW 2 65,542,252 (GRCm39) missense probably damaging 1.00
PIT4520001:Scn2a UTSW 2 65,518,763 (GRCm39) missense probably damaging 1.00
R0021:Scn2a UTSW 2 65,500,859 (GRCm39) missense possibly damaging 0.51
R0141:Scn2a UTSW 2 65,542,160 (GRCm39) missense probably benign 0.01
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0240:Scn2a UTSW 2 65,566,118 (GRCm39) missense probably benign 0.32
R0335:Scn2a UTSW 2 65,512,435 (GRCm39) missense probably damaging 1.00
R0508:Scn2a UTSW 2 65,548,186 (GRCm39) missense probably damaging 0.99
R0558:Scn2a UTSW 2 65,542,269 (GRCm39) missense probably benign 0.26
R0600:Scn2a UTSW 2 65,532,177 (GRCm39) missense possibly damaging 0.90
R0667:Scn2a UTSW 2 65,582,340 (GRCm39) missense possibly damaging 0.91
R1178:Scn2a UTSW 2 65,517,123 (GRCm39) splice site probably benign
R1244:Scn2a UTSW 2 65,593,999 (GRCm39) missense probably damaging 0.98
R1386:Scn2a UTSW 2 65,519,085 (GRCm39) missense probably damaging 1.00
R1434:Scn2a UTSW 2 65,532,335 (GRCm39) missense possibly damaging 0.79
R1440:Scn2a UTSW 2 65,594,938 (GRCm39) missense probably benign
R1448:Scn2a UTSW 2 65,514,189 (GRCm39) missense probably benign 0.17
R1460:Scn2a UTSW 2 65,532,187 (GRCm39) missense probably damaging 0.96
R1553:Scn2a UTSW 2 65,544,180 (GRCm39) nonsense probably null
R1642:Scn2a UTSW 2 65,514,041 (GRCm39) missense probably damaging 1.00
R1803:Scn2a UTSW 2 65,501,111 (GRCm39) splice site probably null
R1981:Scn2a UTSW 2 65,520,514 (GRCm39) missense probably damaging 1.00
R2002:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R2068:Scn2a UTSW 2 65,582,417 (GRCm39) missense probably benign 0.14
R2125:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2126:Scn2a UTSW 2 65,582,423 (GRCm39) nonsense probably null
R2876:Scn2a UTSW 2 65,546,241 (GRCm39) missense possibly damaging 0.64
R2878:Scn2a UTSW 2 65,518,715 (GRCm39) missense probably damaging 1.00
R3113:Scn2a UTSW 2 65,579,129 (GRCm39) missense possibly damaging 0.86
R3749:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3750:Scn2a UTSW 2 65,544,115 (GRCm39) missense probably damaging 1.00
R3765:Scn2a UTSW 2 65,513,054 (GRCm39) missense possibly damaging 0.51
R3850:Scn2a UTSW 2 65,512,375 (GRCm39) missense probably benign 0.14
R4585:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4586:Scn2a UTSW 2 65,573,395 (GRCm39) splice site probably null
R4588:Scn2a UTSW 2 65,544,111 (GRCm39) missense possibly damaging 0.76
R4622:Scn2a UTSW 2 65,582,371 (GRCm39) missense probably benign 0.04
R5108:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R5161:Scn2a UTSW 2 65,594,935 (GRCm39) missense probably benign 0.00
R5235:Scn2a UTSW 2 65,582,355 (GRCm39) missense probably damaging 1.00
R5464:Scn2a UTSW 2 65,532,100 (GRCm39) missense probably damaging 1.00
R5586:Scn2a UTSW 2 65,537,639 (GRCm39) nonsense probably null
R5630:Scn2a UTSW 2 65,556,709 (GRCm39) missense probably damaging 1.00
R5715:Scn2a UTSW 2 65,547,928 (GRCm39) missense probably benign 0.27
R5730:Scn2a UTSW 2 65,512,882 (GRCm39) nonsense probably null
R5734:Scn2a UTSW 2 65,548,066 (GRCm39) missense possibly damaging 0.49
R5779:Scn2a UTSW 2 65,594,827 (GRCm39) missense probably benign 0.00
R6133:Scn2a UTSW 2 65,573,448 (GRCm39) missense probably benign 0.35
R6547:Scn2a UTSW 2 65,546,241 (GRCm39) missense probably benign 0.29
R6549:Scn2a UTSW 2 65,595,018 (GRCm39) missense probably benign 0.05
R6818:Scn2a UTSW 2 65,519,013 (GRCm39) nonsense probably null
R6999:Scn2a UTSW 2 65,512,453 (GRCm39) missense probably benign
R7073:Scn2a UTSW 2 65,558,787 (GRCm39) missense probably benign 0.00
R7125:Scn2a UTSW 2 65,594,277 (GRCm39) missense probably damaging 1.00
R7178:Scn2a UTSW 2 65,579,197 (GRCm39) nonsense probably null
R7179:Scn2a UTSW 2 65,532,323 (GRCm39) missense probably damaging 1.00
R7203:Scn2a UTSW 2 65,578,663 (GRCm39) missense probably benign 0.01
R7227:Scn2a UTSW 2 65,582,367 (GRCm39) missense probably damaging 0.98
R7269:Scn2a UTSW 2 65,594,113 (GRCm39) missense probably damaging 1.00
R7358:Scn2a UTSW 2 65,512,850 (GRCm39) nonsense probably null
R7388:Scn2a UTSW 2 65,518,998 (GRCm39) missense probably damaging 1.00
R7491:Scn2a UTSW 2 65,532,352 (GRCm39) missense probably damaging 0.99
R7619:Scn2a UTSW 2 65,546,247 (GRCm39) missense probably damaging 1.00
R7695:Scn2a UTSW 2 65,542,251 (GRCm39) missense probably damaging 0.99
R7735:Scn2a UTSW 2 65,594,013 (GRCm39) missense probably benign 0.40
R7911:Scn2a UTSW 2 65,512,427 (GRCm39) missense probably null 1.00
R8096:Scn2a UTSW 2 65,594,366 (GRCm39) missense probably damaging 0.98
R8172:Scn2a UTSW 2 65,520,672 (GRCm39) missense probably benign 0.01
R8220:Scn2a UTSW 2 65,520,620 (GRCm39) missense probably benign 0.01
R8333:Scn2a UTSW 2 65,514,191 (GRCm39) missense probably benign 0.01
R8416:Scn2a UTSW 2 65,511,345 (GRCm39) missense probably benign 0.00
R8850:Scn2a UTSW 2 65,518,730 (GRCm39) missense probably damaging 1.00
R8897:Scn2a UTSW 2 65,546,002 (GRCm39) critical splice acceptor site probably null
R8977:Scn2a UTSW 2 65,594,014 (GRCm39) missense probably damaging 0.99
R8992:Scn2a UTSW 2 65,594,242 (GRCm39) missense probably damaging 1.00
R9190:Scn2a UTSW 2 65,511,346 (GRCm39) missense probably benign 0.00
R9206:Scn2a UTSW 2 65,548,131 (GRCm39) missense probably damaging 1.00
R9355:Scn2a UTSW 2 65,594,433 (GRCm39) missense probably damaging 1.00
R9452:Scn2a UTSW 2 65,595,163 (GRCm39) missense probably benign
R9529:Scn2a UTSW 2 65,594,932 (GRCm39) missense probably damaging 0.99
R9567:Scn2a UTSW 2 65,518,974 (GRCm39) missense probably damaging 1.00
R9569:Scn2a UTSW 2 65,560,622 (GRCm39) missense probably damaging 1.00
R9657:Scn2a UTSW 2 65,566,032 (GRCm39) missense probably damaging 1.00
R9715:Scn2a UTSW 2 65,579,149 (GRCm39) missense possibly damaging 0.93
R9761:Scn2a UTSW 2 65,566,030 (GRCm39) missense probably damaging 1.00
Z1176:Scn2a UTSW 2 65,582,212 (GRCm39) missense possibly damaging 0.84
Z1177:Scn2a UTSW 2 65,548,079 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATGCTCTTCGAATCCAGATGG -3'
(R):5'- AGGGAGTCGCAGATACATCAC -3'

Sequencing Primer
(F):5'- GAAGAGCGGTTCATGGCTTCC -3'
(R):5'- CACAGGCTGTAAACAGTTGATC -3'
Posted On 2019-05-13