Incidental Mutation 'R7069:Aasdh'
ID548740
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Nameaminoadipate-semialdehyde dehydrogenase
SynonymsA230062G08Rik
MMRRC Submission
Accession Numbers

Genbank: NM_173765.3; Ensembl: ENSMUST00000120963

Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7069 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location76873659-76905514 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76876356 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 991 (I991L)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000121160] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000163347]
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: I991L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: I991L

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: I991L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: I991L

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000121160
SMART Domains Protein: ENSMUSP00000113947
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 45 172 1.8e-41 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
low complexity region 1034 1047 N/A INTRINSIC
low complexity region 1271 1283 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
AA Change: I150L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: I150L

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,901 F97Y probably damaging Het
4932415D10Rik G A 10: 82,289,943 T2411I probably damaging Het
Actg2 C A 6: 83,520,763 G96V probably damaging Het
Adh5 T A 3: 138,451,051 L166* probably null Het
Akap13 A G 7: 75,610,262 D75G probably benign Het
Ank2 T C 3: 126,946,298 probably benign Het
Arfgap1 T A 2: 180,974,120 D197E probably benign Het
Aste1 T C 9: 105,396,707 probably null Het
Atp8b2 T A 3: 89,954,571 N78I probably damaging Het
Btbd11 C A 10: 85,387,656 R110S unknown Het
Cacna2d3 T A 14: 28,969,303 probably benign Het
Chrd T A 16: 20,739,433 W809R probably damaging Het
Col2a1 C T 15: 97,998,588 G60D unknown Het
Coro7 T A 16: 4,679,611 M1L probably damaging Het
Dhx40 T C 11: 86,797,743 I285V probably benign Het
Dopey1 T C 9: 86,550,169 probably null Het
Enox1 A T 14: 77,611,324 R358S probably damaging Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Fam196b T A 11: 34,402,677 C240S possibly damaging Het
Fam221a A C 6: 49,378,498 Q178P probably damaging Het
Fcho1 A C 8: 71,710,497 probably null Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gal3st2b A T 1: 93,940,619 N189Y possibly damaging Het
Ghr T A 15: 3,320,484 D404V probably damaging Het
Glis3 A T 19: 28,531,519 V355D probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm21671 A T 5: 25,949,844 S253T possibly damaging Het
Gpr12 A C 5: 146,583,539 V32G possibly damaging Het
Gspt1 T A 16: 11,222,661 L593F probably damaging Het
H2-Q7 A T 17: 35,440,031 T153S probably damaging Het
Hars2 A G 18: 36,787,956 I194V probably damaging Het
Hdac9 T A 12: 34,429,549 T202S possibly damaging Het
Hoxd13 T C 2: 74,669,024 Y239H probably damaging Het
Insm2 C T 12: 55,599,836 Q122* probably null Het
Ip6k1 T A 9: 108,045,452 probably null Het
Ippk T C 13: 49,461,743 V534A probably damaging Het
Itch T G 2: 155,209,994 F611C probably damaging Het
Itga1 A T 13: 114,968,240 N1083K probably damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kif18a T C 2: 109,295,002 S255P probably damaging Het
Klhl24 C G 16: 20,107,481 T253R probably benign Het
Krt81 T A 15: 101,460,728 T307S possibly damaging Het
Lbr A T 1: 181,828,789 W265R probably damaging Het
Lgals3bp T C 11: 118,393,173 T527A probably benign Het
Lzts1 A C 8: 69,140,745 V70G probably damaging Het
Map3k6 C T 4: 133,251,712 P1154S probably benign Het
Masp1 T C 16: 23,452,455 D681G probably benign Het
Mdga2 T C 12: 66,486,752 N948D probably benign Het
Mettl4 A T 17: 94,733,633 F364L probably damaging Het
Mosmo T C 7: 120,677,832 I23T probably benign Het
Mtg1 G A 7: 140,143,744 V96I probably benign Het
Myh11 T A 16: 14,218,939 R966S possibly damaging Het
Ncapg2 A G 12: 116,424,717 probably null Het
Nid1 G A 13: 13,508,768 V1144I probably benign Het
Olfr1250 T C 2: 89,656,566 I292V probably benign Het
Olfr544 C A 7: 102,484,772 C116F possibly damaging Het
Olfr622 A T 7: 103,639,960 M60K probably damaging Het
Oscar T G 7: 3,611,239 Y167S probably damaging Het
Pa2g4 T C 10: 128,560,690 T200A probably benign Het
Pcdh7 A G 5: 57,719,784 D227G probably benign Het
Plce1 G A 19: 38,758,940 G1702R probably damaging Het
Plxna2 C A 1: 194,793,904 T1144K possibly damaging Het
Prl8a8 G A 13: 27,511,467 T99I probably benign Het
Prr29 C A 11: 106,376,259 H83Q probably damaging Het
Raly T A 2: 154,859,744 I108N possibly damaging Het
Ranbp9 A T 13: 43,419,622 S475R probably benign Het
Rogdi C A 16: 5,013,498 probably benign Het
Rorc C T 3: 94,372,907 Q6* probably null Het
Sacs T C 14: 61,212,496 L3997S probably damaging Het
Scn2a A T 2: 65,764,606 Y1933F probably benign Het
Sik3 T C 9: 46,210,743 L898P probably damaging Het
Sipa1l1 A G 12: 82,341,406 I135M probably damaging Het
Slc26a3 C A 12: 31,450,935 Q224K probably damaging Het
Sobp G T 10: 43,021,440 N716K probably benign Het
Spata16 A G 3: 26,927,334 D513G probably damaging Het
Stac T C 9: 111,572,326 R351G possibly damaging Het
Tecta T A 9: 42,394,941 T64S probably benign Het
Tert G A 13: 73,628,410 V427M probably damaging Het
Tex15 G A 8: 33,570,720 M333I probably benign Het
Tmbim4 A T 10: 120,220,759 Q72L probably benign Het
Trav9n-4 T C 14: 53,294,799 S37P probably benign Het
Trpv5 A T 6: 41,675,960 M93K possibly damaging Het
Ulk4 T C 9: 121,258,810 E272G probably benign Het
Ulk4 T C 9: 121,266,517 T79A probably benign Het
Upb1 A G 10: 75,412,768 N41D probably benign Het
Wls A T 3: 159,934,329 Y532F probably damaging Het
Zdhhc5 G A 2: 84,715,011 probably benign Het
Zfp109 T C 7: 24,229,360 D216G probably benign Het
Zfp473 G A 7: 44,732,374 A845V probably damaging Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 76878534 unclassified probably benign
IGL01013:Aasdh APN 5 76886206 missense possibly damaging 0.68
IGL01558:Aasdh APN 5 76888617 missense possibly damaging 0.89
IGL02544:Aasdh APN 5 76902114 missense probably benign 0.27
IGL02614:Aasdh APN 5 76896368 splice site probably benign
IGL02678:Aasdh APN 5 76888020 splice site probably benign
IGL02739:Aasdh APN 5 76878517 missense possibly damaging 0.64
IGL02947:Aasdh APN 5 76902110 missense probably benign 0.01
IGL03116:Aasdh APN 5 76902089 unclassified probably null
IGL03398:Aasdh APN 5 76891719 missense probably benign 0.02
1mM(1):Aasdh UTSW 5 76896617 missense possibly damaging 0.91
R0183:Aasdh UTSW 5 76886235 missense probably benign 0.05
R0226:Aasdh UTSW 5 76902002 missense probably damaging 1.00
R0367:Aasdh UTSW 5 76902114 missense probably damaging 0.99
R0386:Aasdh UTSW 5 76896461 missense probably damaging 0.98
R0529:Aasdh UTSW 5 76876267 nonsense probably null
R0881:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R0882:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1033:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1034:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1035:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1036:Aasdh UTSW 5 76876283 missense probably damaging 1.00
R1366:Aasdh UTSW 5 76888804 missense probably benign 0.10
R1446:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1449:Aasdh UTSW 5 76886289 missense probably benign 0.45
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1469:Aasdh UTSW 5 76891679 missense probably damaging 0.97
R1583:Aasdh UTSW 5 76882681 missense probably benign 0.00
R1641:Aasdh UTSW 5 76891779 missense probably benign 0.36
R1876:Aasdh UTSW 5 76877549 missense probably damaging 1.00
R1895:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R1946:Aasdh UTSW 5 76891704 missense probably damaging 1.00
R3615:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3616:Aasdh UTSW 5 76888782 missense probably benign 0.20
R3746:Aasdh UTSW 5 76888654 nonsense probably null
R3747:Aasdh UTSW 5 76888654 nonsense probably null
R3748:Aasdh UTSW 5 76888654 nonsense probably null
R3750:Aasdh UTSW 5 76888654 nonsense probably null
R3836:Aasdh UTSW 5 76878468 missense probably benign 0.32
R4857:Aasdh UTSW 5 76887284 missense probably benign 0.01
R4928:Aasdh UTSW 5 76896688 missense possibly damaging 0.65
R4937:Aasdh UTSW 5 76888654 nonsense probably null
R5762:Aasdh UTSW 5 76896598 missense probably benign 0.00
R5866:Aasdh UTSW 5 76876211 missense probably damaging 1.00
R5940:Aasdh UTSW 5 76882898 missense probably benign 0.07
R6253:Aasdh UTSW 5 76886258 missense possibly damaging 0.81
R6542:Aasdh UTSW 5 76883055 missense probably damaging 1.00
R6825:Aasdh UTSW 5 76888849 splice site probably null
R6868:Aasdh UTSW 5 76891680 missense probably damaging 0.99
R6876:Aasdh UTSW 5 76896441 missense probably damaging 1.00
R6961:Aasdh UTSW 5 76876301 missense probably damaging 1.00
R6963:Aasdh UTSW 5 76896456 missense probably damaging 0.99
R7220:Aasdh UTSW 5 76901925 missense probably benign 0.13
R7545:Aasdh UTSW 5 76880014 missense probably damaging 1.00
R7673:Aasdh UTSW 5 76882708 missense probably benign 0.03
R7703:Aasdh UTSW 5 76888077 missense probably damaging 0.99
R7890:Aasdh UTSW 5 76884122 missense probably benign 0.19
R7978:Aasdh UTSW 5 76888668 missense probably damaging 0.99
R8046:Aasdh UTSW 5 76896478 missense probably benign
R8152:Aasdh UTSW 5 76896458 missense probably damaging 1.00
Z1088:Aasdh UTSW 5 76901157 splice site probably null
Z1176:Aasdh UTSW 5 76891796 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CAGTTTCCCGTCAGTGGATG -3'
(R):5'- GCTTTTACCACTGGAGCAGTTC -3'

Sequencing Primer
(F):5'- AGTGGATGCCGCTGCCAG -3'
(R):5'- AGAGCGCTACTTCCCAGAGAG -3'
Posted On2019-05-13