Mutagenetix > Incidental Mutations

Incidental Mutation 'R7069:Akap13'

548750

Institutional Source

Beutler Lab

Gene Symbol

Akap13

Ensembl Gene

ENSMUSG00000066406

Gene Name

A kinase (PRKA) anchor protein 13

Synonyms

AKAP-Lbc, 5730522G15Rik, 1700026G02Rik, PROTO-LBC, PROTO-LB, Ht31, 5830460E08Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7069 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

75455534-75754609 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75610262 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 75 (D75G)

Ref Sequence

ENSEMBL: ENSMUSP00000146990 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166315] [ENSMUST00000207750] [ENSMUST00000207923]

Predicted Effect

probably benign
Transcript: ENSMUST00000166315
AA Change: D878G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000129784
Gene: ENSMUSG00000066406
AA Change: D878G

Domain	Start	End	E-Value	Type
low complexity region	174	184	N/A	INTRINSIC
low complexity region	773	789	N/A	INTRINSIC
low complexity region	896	908	N/A	INTRINSIC
low complexity region	1021	1032	N/A	INTRINSIC
low complexity region	1433	1448	N/A	INTRINSIC
low complexity region	1483	1505	N/A	INTRINSIC
low complexity region	1583	1594	N/A	INTRINSIC
low complexity region	1720	1750	N/A	INTRINSIC
C1	1755	1801	1.95e-4	SMART
low complexity region	1858	1869	N/A	INTRINSIC
RhoGEF	1961	2153	1.28e-61	SMART
PH	2195	2298	2.94e-11	SMART
coiled coil region	2308	2345	N/A	INTRINSIC
low complexity region	2393	2412	N/A	INTRINSIC
low complexity region	2444	2454	N/A	INTRINSIC
coiled coil region	2533	2646	N/A	INTRINSIC
low complexity region	2728	2734	N/A	INTRINSIC
low complexity region	2740	2753	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000207750
AA Change: D878G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000207923
AA Change: D75G

PolyPhen 2 Score 0.287 (Sensitivity: 0.91; Specificity: 0.88)

Predicted Effect

probably benign
Transcript: ENSMUST00000208708

Meta Mutation Damage Score

0.0693

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

98% (86/88)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms containing c-terminal dbl oncogene homology (DH) and pleckstrin homology (PH) domains. The DH domain is associated with guanine nucleotide exchange activation for the Rho/Rac family of small GTP binding proteins, resulting in the conversion of the inactive GTPase to the active form capable of transducing signals. The PH domain has multiple functions. Therefore, these isoforms function as scaffolding proteins to coordinate a Rho signaling pathway, function as protein kinase A-anchoring proteins and, in addition, enhance ligand-dependent activity of estrogen receptors alpha and beta. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis, arrested heart development, and forebrain hypoplasia. Heterozygous mice exhibit small spleen, impaired lymphocyte response to osmotic stress, decreased response to glucocorticoid, osteoporosis and impared osteogenesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,631,901	F97Y	probably damaging	Het
4932415D10Rik	G	A	10: 82,289,943	T2411I	probably damaging	Het
Aasdh	T	A	5: 76,876,356	I991L	probably benign	Het
Actg2	C	A	6: 83,520,763	G96V	probably damaging	Het
Adh5	T	A	3: 138,451,051	L166*	probably null	Het
Ank2	T	C	3: 126,946,298		probably benign	Het
Arfgap1	T	A	2: 180,974,120	D197E	probably benign	Het
Aste1	T	C	9: 105,396,707		probably null	Het
Atp8b2	T	A	3: 89,954,571	N78I	probably damaging	Het
Btbd11	C	A	10: 85,387,656	R110S	unknown	Het
Cacna2d3	T	A	14: 28,969,303		probably benign	Het
Chrd	T	A	16: 20,739,433	W809R	probably damaging	Het
Col2a1	C	T	15: 97,998,588	G60D	unknown	Het
Coro7	T	A	16: 4,679,611	M1L	probably damaging	Het
Dhx40	T	C	11: 86,797,743	I285V	probably benign	Het
Dopey1	T	C	9: 86,550,169		probably null	Het
Enox1	A	T	14: 77,611,324	R358S	probably damaging	Het
Ep400	A	G	5: 110,668,124	V2724A	probably damaging	Het
Fam196b	T	A	11: 34,402,677	C240S	possibly damaging	Het
Fam221a	A	C	6: 49,378,498	Q178P	probably damaging	Het
Fcho1	A	C	8: 71,710,497		probably null	Het
Fndc1	A	T	17: 7,769,735	V1165D	unknown	Het
Gal3st2b	A	T	1: 93,940,619	N189Y	possibly damaging	Het
Ghr	T	A	15: 3,320,484	D404V	probably damaging	Het
Glis3	A	T	19: 28,531,519	V355D	probably damaging	Het
Gm15922	C	G	7: 3,737,320	A301P	probably damaging	Het
Gm21671	A	T	5: 25,949,844	S253T	possibly damaging	Het
Gpr12	A	C	5: 146,583,539	V32G	possibly damaging	Het
Gspt1	T	A	16: 11,222,661	L593F	probably damaging	Het
H2-Q7	A	T	17: 35,440,031	T153S	probably damaging	Het
Hars2	A	G	18: 36,787,956	I194V	probably damaging	Het
Hdac9	T	A	12: 34,429,549	T202S	possibly damaging	Het
Hoxd13	T	C	2: 74,669,024	Y239H	probably damaging	Het
Insm2	C	T	12: 55,599,836	Q122*	probably null	Het
Ip6k1	T	A	9: 108,045,452		probably null	Het
Ippk	T	C	13: 49,461,743	V534A	probably damaging	Het
Itch	T	G	2: 155,209,994	F611C	probably damaging	Het
Itga1	A	T	13: 114,968,240	N1083K	probably damaging	Het
Itgae	A	C	11: 73,116,143	D405A	probably damaging	Het
Kif18a	T	C	2: 109,295,002	S255P	probably damaging	Het
Klhl24	C	G	16: 20,107,481	T253R	probably benign	Het
Krt81	T	A	15: 101,460,728	T307S	possibly damaging	Het
Lbr	A	T	1: 181,828,789	W265R	probably damaging	Het
Lgals3bp	T	C	11: 118,393,173	T527A	probably benign	Het
Lzts1	A	C	8: 69,140,745	V70G	probably damaging	Het
Map3k6	C	T	4: 133,251,712	P1154S	probably benign	Het
Masp1	T	C	16: 23,452,455	D681G	probably benign	Het
Mdga2	T	C	12: 66,486,752	N948D	probably benign	Het
Mettl4	A	T	17: 94,733,633	F364L	probably damaging	Het
Mosmo	T	C	7: 120,677,832	I23T	probably benign	Het
Mtg1	G	A	7: 140,143,744	V96I	probably benign	Het
Myh11	T	A	16: 14,218,939	R966S	possibly damaging	Het
Ncapg2	A	G	12: 116,424,717		probably null	Het
Nid1	G	A	13: 13,508,768	V1144I	probably benign	Het
Olfr1250	T	C	2: 89,656,566	I292V	probably benign	Het
Olfr544	C	A	7: 102,484,772	C116F	possibly damaging	Het
Olfr622	A	T	7: 103,639,960	M60K	probably damaging	Het
Oscar	T	G	7: 3,611,239	Y167S	probably damaging	Het
Pa2g4	T	C	10: 128,560,690	T200A	probably benign	Het
Pcdh7	A	G	5: 57,719,784	D227G	probably benign	Het
Plce1	G	A	19: 38,758,940	G1702R	probably damaging	Het
Plxna2	C	A	1: 194,793,904	T1144K	possibly damaging	Het
Prl8a8	G	A	13: 27,511,467	T99I	probably benign	Het
Prr29	C	A	11: 106,376,259	H83Q	probably damaging	Het
Raly	T	A	2: 154,859,744	I108N	possibly damaging	Het
Ranbp9	A	T	13: 43,419,622	S475R	probably benign	Het
Rogdi	C	A	16: 5,013,498		probably benign	Het
Rorc	C	T	3: 94,372,907	Q6*	probably null	Het
Sacs	T	C	14: 61,212,496	L3997S	probably damaging	Het
Scn2a	A	T	2: 65,764,606	Y1933F	probably benign	Het
Sik3	T	C	9: 46,210,743	L898P	probably damaging	Het
Sipa1l1	A	G	12: 82,341,406	I135M	probably damaging	Het
Slc26a3	C	A	12: 31,450,935	Q224K	probably damaging	Het
Sobp	G	T	10: 43,021,440	N716K	probably benign	Het
Spata16	A	G	3: 26,927,334	D513G	probably damaging	Het
Stac	T	C	9: 111,572,326	R351G	possibly damaging	Het
Tecta	T	A	9: 42,394,941	T64S	probably benign	Het
Tert	G	A	13: 73,628,410	V427M	probably damaging	Het
Tex15	G	A	8: 33,570,720	M333I	probably benign	Het
Tmbim4	A	T	10: 120,220,759	Q72L	probably benign	Het
Trav9n-4	T	C	14: 53,294,799	S37P	probably benign	Het
Trpv5	A	T	6: 41,675,960	M93K	possibly damaging	Het
Ulk4	T	C	9: 121,258,810	E272G	probably benign	Het
Ulk4	T	C	9: 121,266,517	T79A	probably benign	Het
Upb1	A	G	10: 75,412,768	N41D	probably benign	Het
Wls	A	T	3: 159,934,329	Y532F	probably damaging	Het
Zdhhc5	G	A	2: 84,715,011		probably benign	Het
Zfp109	T	C	7: 24,229,360	D216G	probably benign	Het
Zfp473	G	A	7: 44,732,374	A845V	probably damaging	Het

Other mutations in Akap13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Akap13	APN	7	75725971	missense	probably damaging	0.99
IGL00332:Akap13	APN	7	75728919	missense	probably damaging	1.00
IGL00481:Akap13	APN	7	75723895	missense	probably damaging	1.00
IGL00590:Akap13	APN	7	75610669	missense	probably benign	0.01
IGL00655:Akap13	APN	7	75704398	missense	probably damaging	0.99
IGL00766:Akap13	APN	7	75704512	missense	probably damaging	0.96
IGL00818:Akap13	APN	7	75609727	missense	probably benign	0.00
IGL00826:Akap13	APN	7	75677447	missense	probably damaging	1.00
IGL01014:Akap13	APN	7	75750633	utr 3 prime	probably benign
IGL01090:Akap13	APN	7	75666531	missense	probably benign	0.44
IGL01155:Akap13	APN	7	75569936	missense	probably damaging	1.00
IGL01326:Akap13	APN	7	75725348	missense	probably benign	0.30
IGL01456:Akap13	APN	7	75602847	missense	probably damaging	0.98
IGL01460:Akap13	APN	7	75747846	missense	probably benign	0.29
IGL01568:Akap13	APN	7	75608522	nonsense	probably null	0.00
IGL01610:Akap13	APN	7	75720180	missense	possibly damaging	0.71
IGL01610:Akap13	APN	7	75747605	missense	probably damaging	1.00
IGL01615:Akap13	APN	7	75697393	missense	probably damaging	1.00
IGL01667:Akap13	APN	7	75570019	missense	probably damaging	1.00
IGL01705:Akap13	APN	7	75746767	missense	possibly damaging	0.86
IGL02070:Akap13	APN	7	75666545	missense	probably benign	0.27
IGL02269:Akap13	APN	7	75602911	missense	probably benign
IGL02421:Akap13	APN	7	75717806	missense	possibly damaging	0.66
IGL02870:Akap13	APN	7	75609188	missense	probably damaging	0.96
IGL02944:Akap13	APN	7	75608657	missense	probably benign
IGL03051:Akap13	APN	7	75610485	nonsense	probably null
IGL03160:Akap13	APN	7	75730417	missense	probably damaging	1.00
IGL03245:Akap13	APN	7	75609752	missense	probably damaging	0.99
R0254:Akap13	UTSW	7	75736604	splice site	probably benign
R0310:Akap13	UTSW	7	75614930	missense	probably damaging	0.99
R0373:Akap13	UTSW	7	75609929	missense	probably benign	0.00
R0373:Akap13	UTSW	7	75730500	missense	probably damaging	1.00
R0408:Akap13	UTSW	7	75746796	missense	probably damaging	1.00
R0631:Akap13	UTSW	7	75614996	missense	probably damaging	0.99
R0646:Akap13	UTSW	7	75747746	missense	probably damaging	1.00
R0781:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R0845:Akap13	UTSW	7	75725380	missense	probably damaging	1.00
R1004:Akap13	UTSW	7	75687286	missense	probably damaging	0.99
R1024:Akap13	UTSW	7	75677409	missense	probably damaging	1.00
R1110:Akap13	UTSW	7	75611377	missense	possibly damaging	0.56
R1346:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1349:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1372:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1387:Akap13	UTSW	7	75586193	missense	probably damaging	0.97
R1442:Akap13	UTSW	7	75735778	missense	probably damaging	0.99
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1466:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1584:Akap13	UTSW	7	75729049	missense	possibly damaging	0.79
R1696:Akap13	UTSW	7	75609592	missense	possibly damaging	0.67
R1738:Akap13	UTSW	7	75677194	missense	probably damaging	1.00
R1773:Akap13	UTSW	7	75683451	missense	possibly damaging	0.80
R1785:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1786:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R1791:Akap13	UTSW	7	75611035	missense	probably benign	0.00
R1819:Akap13	UTSW	7	75608705	missense	probably benign	0.04
R1879:Akap13	UTSW	7	75610727	missense	probably benign	0.01
R1989:Akap13	UTSW	7	75704516	missense	probably benign	0.01
R2016:Akap13	UTSW	7	75704531	missense	probably damaging	0.99
R2092:Akap13	UTSW	7	75610570	missense	probably benign	0.05
R2126:Akap13	UTSW	7	75725304	missense	possibly damaging	0.95
R2131:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2132:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2133:Akap13	UTSW	7	75611434	missense	probably benign	0.16
R2251:Akap13	UTSW	7	75739477	missense	possibly damaging	0.50
R3704:Akap13	UTSW	7	75666550	missense	probably damaging	1.00
R3713:Akap13	UTSW	7	75586181	missense	probably damaging	0.98
R3731:Akap13	UTSW	7	75611377	missense	probably benign	0.39
R3765:Akap13	UTSW	7	75608837	missense	probably benign	0.04
R3788:Akap13	UTSW	7	75702153	critical splice donor site	probably null
R3793:Akap13	UTSW	7	75610141	missense	probably benign	0.00
R3970:Akap13	UTSW	7	75569951	nonsense	probably null
R4205:Akap13	UTSW	7	75610919	missense	probably benign	0.05
R4257:Akap13	UTSW	7	75611285	missense	probably damaging	0.98
R4374:Akap13	UTSW	7	75608984	missense	probably damaging	0.96
R4448:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4450:Akap13	UTSW	7	75742760	missense	probably damaging	1.00
R4457:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4458:Akap13	UTSW	7	75739465	missense	probably damaging	0.99
R4466:Akap13	UTSW	7	75602773	splice site	probably null
R4632:Akap13	UTSW	7	75666553	missense	possibly damaging	0.91
R4667:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4669:Akap13	UTSW	7	75729094	missense	probably damaging	1.00
R4671:Akap13	UTSW	7	75579564	nonsense	probably null
R4821:Akap13	UTSW	7	75677507	intron	probably benign
R4868:Akap13	UTSW	7	75743504	missense	probably damaging	1.00
R4894:Akap13	UTSW	7	75725320	missense	possibly damaging	0.76
R4943:Akap13	UTSW	7	75749240	missense	probably benign	0.22
R4962:Akap13	UTSW	7	75749430	missense	probably damaging	0.98
R4988:Akap13	UTSW	7	75730528	missense	probably damaging	1.00
R5119:Akap13	UTSW	7	75687252	missense	probably damaging	0.98
R5141:Akap13	UTSW	7	75609614	missense	probably benign	0.18
R5419:Akap13	UTSW	7	75610243	missense	probably benign	0.01
R5427:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R5429:Akap13	UTSW	7	75602904	missense	possibly damaging	0.70
R5432:Akap13	UTSW	7	75602830	missense	probably damaging	1.00
R5458:Akap13	UTSW	7	75586301	missense	probably damaging	1.00
R5636:Akap13	UTSW	7	75704372	missense	probably damaging	0.96
R5643:Akap13	UTSW	7	75702154	critical splice donor site	probably null
R5898:Akap13	UTSW	7	75729146	missense	probably damaging	1.00
R5932:Akap13	UTSW	7	75610184	missense	probably damaging	1.00
R6135:Akap13	UTSW	7	75609908	missense	possibly damaging	0.94
R6137:Akap13	UTSW	7	75677416	missense	probably damaging	1.00
R6182:Akap13	UTSW	7	75586280	missense	probably benign	0.45
R6310:Akap13	UTSW	7	75749193	missense	probably damaging	0.99
R6346:Akap13	UTSW	7	75685254	missense	probably damaging	1.00
R6466:Akap13	UTSW	7	75727044	missense	probably benign	0.01
R6605:Akap13	UTSW	7	75579768	missense	probably damaging	0.98
R6617:Akap13	UTSW	7	75730363	missense	possibly damaging	0.95
R6621:Akap13	UTSW	7	75569981	missense	probably damaging	1.00
R6703:Akap13	UTSW	7	75602898	missense	probably damaging	1.00
R6750:Akap13	UTSW	7	75739458	missense	probably benign	0.03
R7116:Akap13	UTSW	7	75720195	missense	probably benign	0.00
R7158:Akap13	UTSW	7	75579594	missense	probably damaging	0.97
R7159:Akap13	UTSW	7	75730579	missense	possibly damaging	0.72
R7467:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7468:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7471:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7472:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7477:Akap13	UTSW	7	75749247	missense	probably benign
R7636:Akap13	UTSW	7	75609873	missense	probably benign	0.04
R7650:Akap13	UTSW	7	75643454	missense	probably benign	0.20
R7671:Akap13	UTSW	7	75569900	missense	probably damaging	1.00
R7681:Akap13	UTSW	7	75728796	missense	possibly damaging	0.91
R7752:Akap13	UTSW	7	75677258	missense	possibly damaging	0.74
R7784:Akap13	UTSW	7	75610328	missense	probably benign	0.00
R7816:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7817:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R7834:Akap13	UTSW	7	75742642	missense	possibly damaging	0.85
R7880:Akap13	UTSW	7	75586216	missense	probably damaging	0.97
R7942:Akap13	UTSW	7	75611470	missense	possibly damaging	0.50
R8006:Akap13	UTSW	7	75579696	missense	probably damaging	1.00
R8009:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8011:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8012:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8013:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8016:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8089:Akap13	UTSW	7	75610592	missense	possibly damaging	0.94
R8138:Akap13	UTSW	7	75702231	splice site	probably null
R8174:Akap13	UTSW	7	75728869	missense	possibly damaging	0.89
R8298:Akap13	UTSW	7	75747804	missense	probably damaging	1.00
R8444:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8445:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
R8465:Akap13	UTSW	7	75727038	missense	probably benign	0.11
R8512:Akap13	UTSW	7	75611086	missense	probably damaging	0.99
R8523:Akap13	UTSW	7	75730465	missense	probably damaging	1.00
Z1176:Akap13	UTSW	7	75730552	missense	probably damaging	0.99
Z1177:Akap13	UTSW	7	75615005	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- TTGTCGAGATGGCCCAGATG -3'
(R):5'- TCACAGAGTCCTGGTATCTCC -3'

Sequencing Primer
(F):5'- TGGCCCAGATGGAAGAGATTTG -3'
(R):5'- TGGTATCTCCTGCCCAGAG -3'

Posted On

2019-05-13