Mutagenetix > Incidental Mutations

Incidental Mutation 'R0613:Mtor'

54876

Institutional Source

Beutler Lab

Gene Symbol

Mtor

Ensembl Gene

ENSMUSG00000028991

Gene Name

mechanistic target of rapamycin kinase

Synonyms

RAPT1, FKBP-rapamycin-associated protein FRAP, RAFT1, flat, Frap1, 2610315D21Rik

MMRRC Submission

038802-MU

Accession Numbers

Ncbi RefSeq: NM_020009.2; MGI:1928394

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0613 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

148448611-148557683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 148526046 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1605 (Y1605H)

Ref Sequence

ENSEMBL: ENSMUSP00000099510 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000103221]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000103221
AA Change: Y1605H

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000099510
Gene: ENSMUSG00000028991
AA Change: Y1605H

Domain	Start	End	E-Value	Type
low complexity region	7	21	N/A	INTRINSIC
low complexity region	179	191	N/A	INTRINSIC
low complexity region	277	288	N/A	INTRINSIC
low complexity region	774	790	N/A	INTRINSIC
DUF3385	854	1024	1.51e-93	SMART
low complexity region	1279	1300	N/A	INTRINSIC
Pfam:FAT	1513	1908	2.3e-134	PFAM
Rapamycin_bind	2015	2114	7.94e-61	SMART
PI3Kc	2183	2484	8.84e-121	SMART
FATC	2517	2549	2.11e-15	SMART

Meta Mutation Damage Score

0.7691

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

Strain: 3529989; 4820819; 3512186; 5425404; 3052669
Lethality: E11-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a family of phosphatidylinositol kinase-related kinases. These kinases mediate cellular responses to stresses such as DNA damage and nutrient deprivation. This protein acts as the target for the cell-cycle arrest and immunosuppressive effects of the FKBP12-rapamycin complex. The ANGPTL7 gene is located in an intron of this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for targeted, gene trap and ENU-induced null alleles exhibit embryonic lethality by E12.5 with abnormal embryogenesis. Mice homozygous for the ENU mutation further exhibit abnormal brain development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(12) Gene trapped(12) Chemically induced(1)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acd	A	T	8: 105,700,568		probably null	Het
Adcy9	A	G	16: 4,419,539	S3P	probably damaging	Het
Adgrl4	T	C	3: 151,543,222		probably benign	Het
Aff3	T	C	1: 38,209,923	E700G	probably benign	Het
Ahctf1	A	G	1: 179,769,414	S56P	probably damaging	Het
Atp12a	T	A	14: 56,374,521	I384N	probably damaging	Het
Brca1	A	T	11: 101,508,210	S1519T	probably benign	Het
Ccl25	T	C	8: 4,349,850	V94A	probably benign	Het
Cep170	T	C	1: 176,774,680	T287A	probably benign	Het
Ces1a	A	G	8: 93,025,581	S383P	probably benign	Het
Cntnap3	A	T	13: 64,758,414	F793I	probably damaging	Het
Ctsm	T	C	13: 61,539,682	R89G	probably damaging	Het
Cyp2j12	T	G	4: 96,102,079	T417P	probably damaging	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Edn2	T	A	4: 120,161,864		probably null	Het
Emc1	T	A	4: 139,375,072		probably benign	Het
Fam189a2	T	A	19: 23,986,489	N239Y	probably damaging	Het
Fras1	T	C	5: 96,700,488		probably benign	Het
Fsip2	A	T	2: 82,993,795	D6624V	probably damaging	Het
Gpr107	A	G	2: 31,178,285	Y253C	probably damaging	Het
Gpr108	A	G	17: 57,238,174		probably benign	Het
Grik1	A	G	16: 88,051,333		probably null	Het
Gtf3c1	G	A	7: 125,644,134	P1766L	possibly damaging	Het
Gucy2c	A	T	6: 136,760,723	N293K	probably damaging	Het
Hps6	C	A	19: 46,003,821	P66T	probably benign	Het
Hspa9	A	T	18: 34,947,980	V216E	probably damaging	Het
Igsf8	T	A	1: 172,317,589	M224K	probably benign	Het
Igsf9b	T	C	9: 27,326,920	V569A	probably damaging	Het
Itgb4	A	T	11: 115,993,342	I952F	probably damaging	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Khdrbs2	A	G	1: 32,657,522	H344R	possibly damaging	Het
Kmo	C	A	1: 175,637,892	R71S	probably damaging	Het
Lrrc31	A	G	3: 30,685,035		probably benign	Het
Map1b	T	A	13: 99,441,641	D168V	probably damaging	Het
Mfsd6	T	C	1: 52,658,696		probably benign	Het
Mgst1	G	A	6: 138,156,245	G186D	probably damaging	Het
Mrc1	C	T	2: 14,294,819	A740V	probably damaging	Het
Mroh2a	G	A	1: 88,243,950	R770Q	probably damaging	Het
Ncoa4	T	A	14: 32,176,552	L443Q	probably damaging	Het
Nelfa	G	A	5: 33,903,463		probably benign	Het
Nepn	T	A	10: 52,401,257	L363Q	probably damaging	Het
Nfat5	A	G	8: 107,366,295	T630A	possibly damaging	Het
Nipal4	A	T	11: 46,150,384	V328E	probably benign	Het
Olfr1228	A	T	2: 89,249,125	C178S	probably damaging	Het
Olfr1391	T	A	11: 49,327,748	S112R	possibly damaging	Het
Olfr462	A	T	11: 87,889,227	V223E	possibly damaging	Het
Olfr747	T	A	14: 50,681,404	I77F	probably benign	Het
Olfr809	T	A	10: 129,776,262	M116K	probably damaging	Het
Olfr924	T	A	9: 38,848,613	C166*	probably null	Het
Otogl	A	T	10: 107,817,070	N1140K	probably damaging	Het
Ppip5k2	A	C	1: 97,752,740	Y236*	probably null	Het
Prelid1	C	T	13: 55,324,343	R111*	probably null	Het
Prpf8	T	C	11: 75,503,444	L1771P	probably damaging	Het
Ptprb	A	T	10: 116,302,325	Y378F	possibly damaging	Het
Ptprb	A	G	10: 116,302,378	T396A	possibly damaging	Het
Rab3il1	T	C	19: 10,028,364	L174P	probably damaging	Het
Rab4a	T	C	8: 123,823,835	V18A	possibly damaging	Het
Scn3a	T	A	2: 65,472,284	M1273L	possibly damaging	Het
Sdhc	A	T	1: 171,129,844	V156E	probably benign	Het
Slco3a1	T	C	7: 74,346,634		probably benign	Het
Syne3	T	C	12: 104,958,112	T343A	probably benign	Het
Syt11	A	G	3: 88,762,469	C39R	probably damaging	Het
Tll2	G	T	19: 41,104,990	D462E	probably damaging	Het
Tmem132e	T	A	11: 82,438,338	V481D	probably damaging	Het
Tmem161b	C	T	13: 84,251,320	L17F	probably damaging	Het
Vmn2r105	T	A	17: 20,208,316	I833F	probably damaging	Het
Vstm2a	A	T	11: 16,263,140	N175I	probably damaging	Het
Xpnpep1	G	T	19: 53,006,353	D238E	probably damaging	Het
Zfp112	G	A	7: 24,127,028	G807D	probably benign	Het
Zfp518b	A	T	5: 38,673,603	V353E	probably damaging	Het
Zfp69	T	C	4: 120,934,347	E39G	probably benign	Het
Zfp865	A	G	7: 5,029,091	H25R	possibly damaging	Het

Other mutations in Mtor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01123:Mtor	APN	4	148453037	missense	probably benign	0.06
IGL01447:Mtor	APN	4	148530757	missense	possibly damaging	0.62
IGL01551:Mtor	APN	4	148472037	missense	probably damaging	0.99
IGL01661:Mtor	APN	4	148514851	missense	possibly damaging	0.61
IGL01675:Mtor	APN	4	148484654	missense	probably benign	0.00
IGL01743:Mtor	APN	4	148530613	splice site	probably benign
IGL02015:Mtor	APN	4	148540113	nonsense	probably null
IGL02084:Mtor	APN	4	148470680	missense	probably damaging	0.98
IGL02095:Mtor	APN	4	148544541	missense	probably damaging	1.00
IGL02129:Mtor	APN	4	148549845	missense	possibly damaging	0.91
IGL02260:Mtor	APN	4	148538301	missense	probably damaging	1.00
IGL02329:Mtor	APN	4	148534939	missense	probably benign	0.16
IGL02440:Mtor	APN	4	148546429	missense	probably benign	0.24
IGL02440:Mtor	APN	4	148491647	missense	probably benign	0.04
IGL02449:Mtor	APN	4	148533921	missense	possibly damaging	0.65
IGL02479:Mtor	APN	4	148470584	missense	probably damaging	1.00
IGL02904:Mtor	APN	4	148452394	missense	possibly damaging	0.55
IGL02904:Mtor	APN	4	148491612	splice site	probably benign
IGL02931:Mtor	APN	4	148464964	missense	probably benign	0.22
IGL03048:Mtor	APN	4	148546390	splice site	probably benign
IGL03133:Mtor	APN	4	148484319	missense	probably benign	0.01
IGL03142:Mtor	APN	4	148453899	missense	probably benign	0.00
Dynamo	UTSW	4	148462910	missense	probably benign	0.00
engine	UTSW	4	148556855	splice site	probably null
Erg	UTSW	4	148545596	missense	probably damaging	1.00
Lindor	UTSW	4	148454646	missense	probably damaging	1.00
motor	UTSW	4	148491360	missense	possibly damaging	0.76
R4858_Mtor_211	UTSW	4	148454816	makesense	probably null
Vim	UTSW	4	148525803	critical splice donor site	probably null
PIT4519001:Mtor	UTSW	4	148524500	missense	probably damaging	1.00
R0045:Mtor	UTSW	4	148464949	missense	probably benign	0.42
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0048:Mtor	UTSW	4	148538881	nonsense	probably null
R0103:Mtor	UTSW	4	148533902	missense	probably benign	0.05
R0112:Mtor	UTSW	4	148480923	missense	probably damaging	1.00
R0137:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R0184:Mtor	UTSW	4	148464971	missense	probably benign	0.05
R0208:Mtor	UTSW	4	148464975	missense	probably benign	0.43
R0329:Mtor	UTSW	4	148484380	missense	probably benign
R0330:Mtor	UTSW	4	148484380	missense	probably benign
R0365:Mtor	UTSW	4	148486050	missense	probably benign	0.01
R0537:Mtor	UTSW	4	148538360	missense	probably damaging	1.00
R0542:Mtor	UTSW	4	148540450	missense	probably benign	0.02
R0556:Mtor	UTSW	4	148469380	missense	possibly damaging	0.88
R0646:Mtor	UTSW	4	148484354	nonsense	probably null
R0710:Mtor	UTSW	4	148464391	missense	possibly damaging	0.73
R0791:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0792:Mtor	UTSW	4	148462910	missense	probably benign	0.00
R0866:Mtor	UTSW	4	148486056	missense	probably benign	0.04
R0973:Mtor	UTSW	4	148550188	missense	probably damaging	1.00
R1027:Mtor	UTSW	4	148539999	missense	probably benign	0.03
R1028:Mtor	UTSW	4	148538830	missense	possibly damaging	0.88
R1289:Mtor	UTSW	4	148470307	missense	probably benign	0.10
R1416:Mtor	UTSW	4	148491414	nonsense	probably null
R1465:Mtor	UTSW	4	148525993	splice site	probably benign
R1506:Mtor	UTSW	4	148536505	splice site	probably benign
R1624:Mtor	UTSW	4	148547676	missense	probably damaging	1.00
R1695:Mtor	UTSW	4	148538907	missense	probably benign	0.08
R1771:Mtor	UTSW	4	148470624	missense	possibly damaging	0.78
R1800:Mtor	UTSW	4	148462892	missense	probably benign	0.00
R1855:Mtor	UTSW	4	148553089	missense	probably benign	0.02
R1857:Mtor	UTSW	4	148480879	missense	probably damaging	1.00
R1867:Mtor	UTSW	4	148454632	missense	probably damaging	0.97
R1954:Mtor	UTSW	4	148468273	missense	probably damaging	1.00
R2054:Mtor	UTSW	4	148462852	missense	probably benign	0.05
R2054:Mtor	UTSW	4	148466025	missense	probably benign	0.00
R2099:Mtor	UTSW	4	148550192	nonsense	probably null
R2148:Mtor	UTSW	4	148456012	missense	possibly damaging	0.56
R2214:Mtor	UTSW	4	148538870	missense	probably benign	0.39
R2281:Mtor	UTSW	4	148489555	missense	probably benign	0.02
R2512:Mtor	UTSW	4	148530491	missense	possibly damaging	0.95
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2870:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2871:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2872:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R2873:Mtor	UTSW	4	148540030	missense	probably benign	0.00
R4032:Mtor	UTSW	4	148536752	missense	probably benign	0.03
R4073:Mtor	UTSW	4	148549375	missense	probably damaging	0.99
R4273:Mtor	UTSW	4	148550152	missense	probably benign	0.21
R4611:Mtor	UTSW	4	148486119	missense	probably benign	0.03
R4858:Mtor	UTSW	4	148454816	makesense	probably null
R4942:Mtor	UTSW	4	148472142	missense	probably benign	0.03
R4967:Mtor	UTSW	4	148491360	missense	possibly damaging	0.76
R4995:Mtor	UTSW	4	148525752	missense	probably damaging	1.00
R5054:Mtor	UTSW	4	148556855	splice site	probably null
R5215:Mtor	UTSW	4	148453983	missense	probably benign
R5249:Mtor	UTSW	4	148463732	missense	probably damaging	1.00
R5289:Mtor	UTSW	4	148466092	missense	possibly damaging	0.88
R5365:Mtor	UTSW	4	148550130	missense	probably damaging	0.99
R5498:Mtor	UTSW	4	148540364	missense	possibly damaging	0.71
R5514:Mtor	UTSW	4	148546444	missense	probably damaging	1.00
R5540:Mtor	UTSW	4	148454708	missense	probably benign	0.01
R5600:Mtor	UTSW	4	148491470	missense	probably damaging	1.00
R5615:Mtor	UTSW	4	148538276	missense	possibly damaging	0.95
R5632:Mtor	UTSW	4	148469006	missense	possibly damaging	0.94
R5641:Mtor	UTSW	4	148546425	missense	probably damaging	0.98
R5834:Mtor	UTSW	4	148536536	missense	possibly damaging	0.95
R5984:Mtor	UTSW	4	148538827	missense	probably benign	0.02
R6056:Mtor	UTSW	4	148537435	missense	probably benign	0.00
R6225:Mtor	UTSW	4	148521337	missense	probably benign	0.04
R6262:Mtor	UTSW	4	148526095	missense	possibly damaging	0.46
R6335:Mtor	UTSW	4	148465927	missense	probably damaging	1.00
R6479:Mtor	UTSW	4	148551000	missense	probably benign	0.16
R6543:Mtor	UTSW	4	148545596	missense	probably damaging	1.00
R6711:Mtor	UTSW	4	148452367	missense	possibly damaging	0.49
R6715:Mtor	UTSW	4	148538547	missense	probably benign	0.00
R6744:Mtor	UTSW	4	148458655	missense	probably benign	0.01
R6748:Mtor	UTSW	4	148550184	missense	probably damaging	1.00
R6762:Mtor	UTSW	4	148538481	missense	possibly damaging	0.47
R6836:Mtor	UTSW	4	148489498	missense	possibly damaging	0.94
R6948:Mtor	UTSW	4	148536752	missense	probably benign	0.12
R6979:Mtor	UTSW	4	148524473	missense	possibly damaging	0.60
R6992:Mtor	UTSW	4	148464475	missense	probably benign
R7271:Mtor	UTSW	4	148546485	missense	possibly damaging	0.70
R7423:Mtor	UTSW	4	148556344	missense	possibly damaging	0.77
R7434:Mtor	UTSW	4	148464959	missense	probably benign	0.39
R7619:Mtor	UTSW	4	148462795	missense	probably damaging	0.98
R7634:Mtor	UTSW	4	148452350	missense	possibly damaging	0.53
R7697:Mtor	UTSW	4	148540308	nonsense	probably null
R7737:Mtor	UTSW	4	148538738	missense	possibly damaging	0.95
R7791:Mtor	UTSW	4	148462940	missense	probably benign	0.00
R7858:Mtor	UTSW	4	148454646	missense	probably damaging	1.00
R8035:Mtor	UTSW	4	148546399	missense	probably benign	0.29
R8076:Mtor	UTSW	4	148525803	critical splice donor site	probably null
R8078:Mtor	UTSW	4	148468287	missense	probably benign
X0025:Mtor	UTSW	4	148530714	missense	probably benign	0.09
Z1176:Mtor	UTSW	4	148550125	missense	probably benign	0.08
Z1176:Mtor	UTSW	4	148550130	missense	possibly damaging	0.69

Predicted Primers

PCR Primer
(F):5'- GCACGTTGTCAGAATCTACAGCCC -3'
(R):5'- CAGTGAGTCCCAGGTTACCATTTCC -3'

Sequencing Primer
(F):5'- TGTCAGAATCTACAGCCCTAATGAG -3'
(R):5'- ACCATTTCCAAGTGGAGGGTC -3'

Posted On

2013-07-11