Incidental Mutation 'R7069:Itgae'
ID 548770
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms alpha-E1, CD103
MMRRC Submission 045165-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 72981409-73038272 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73006969 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 405 (D405A)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: D405A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: D405A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 77,024,203 (GRCm39) I991L probably benign Het
Abtb3 C A 10: 85,223,520 (GRCm39) R110S unknown Het
Actg2 C A 6: 83,497,745 (GRCm39) G96V probably damaging Het
Adh5 T A 3: 138,156,812 (GRCm39) L166* probably null Het
Akap13 A G 7: 75,260,010 (GRCm39) D75G probably benign Het
Ank2 T C 3: 126,739,947 (GRCm39) probably benign Het
Arfgap1 T A 2: 180,615,913 (GRCm39) D197E probably benign Het
Aste1 T C 9: 105,273,906 (GRCm39) probably null Het
Atp8b2 T A 3: 89,861,878 (GRCm39) N78I probably damaging Het
Cacna2d3 T A 14: 28,691,260 (GRCm39) probably benign Het
Chrd T A 16: 20,558,183 (GRCm39) W809R probably damaging Het
Col2a1 C T 15: 97,896,469 (GRCm39) G60D unknown Het
Coro7 T A 16: 4,497,475 (GRCm39) M1L probably damaging Het
Cracdl A T 1: 37,670,982 (GRCm39) F97Y probably damaging Het
Dhx40 T C 11: 86,688,569 (GRCm39) I285V probably benign Het
Dop1a T C 9: 86,432,222 (GRCm39) probably null Het
Enox1 A T 14: 77,848,764 (GRCm39) R358S probably damaging Het
Ep400 A G 5: 110,815,990 (GRCm39) V2724A probably damaging Het
Fam221a A C 6: 49,355,432 (GRCm39) Q178P probably damaging Het
Fcho1 A C 8: 72,163,141 (GRCm39) probably null Het
Fndc1 A T 17: 7,988,567 (GRCm39) V1165D unknown Het
Gal3st2b A T 1: 93,868,341 (GRCm39) N189Y possibly damaging Het
Ghr T A 15: 3,349,966 (GRCm39) D404V probably damaging Het
Glis3 A T 19: 28,508,919 (GRCm39) V355D probably damaging Het
Gpr12 A C 5: 146,520,349 (GRCm39) V32G possibly damaging Het
Gspt1 T A 16: 11,040,525 (GRCm39) L593F probably damaging Het
H2-Q7 A T 17: 35,659,007 (GRCm39) T153S probably damaging Het
Hars2 A G 18: 36,921,009 (GRCm39) I194V probably damaging Het
Hdac9 T A 12: 34,479,548 (GRCm39) T202S possibly damaging Het
Hoxd13 T C 2: 74,499,368 (GRCm39) Y239H probably damaging Het
Insm2 C T 12: 55,646,621 (GRCm39) Q122* probably null Het
Insyn2b T A 11: 34,352,677 (GRCm39) C240S possibly damaging Het
Ip6k1 T A 9: 107,922,651 (GRCm39) probably null Het
Ippk T C 13: 49,615,219 (GRCm39) V534A probably damaging Het
Itch T G 2: 155,051,914 (GRCm39) F611C probably damaging Het
Itga1 A T 13: 115,104,776 (GRCm39) N1083K probably damaging Het
Kif18a T C 2: 109,125,347 (GRCm39) S255P probably damaging Het
Klhl24 C G 16: 19,926,231 (GRCm39) T253R probably benign Het
Krt81 T A 15: 101,358,609 (GRCm39) T307S possibly damaging Het
Lbr A T 1: 181,656,354 (GRCm39) W265R probably damaging Het
Lgals3bp T C 11: 118,283,999 (GRCm39) T527A probably benign Het
Lzts1 A C 8: 69,593,397 (GRCm39) V70G probably damaging Het
Map3k6 C T 4: 132,979,023 (GRCm39) P1154S probably benign Het
Masp1 T C 16: 23,271,205 (GRCm39) D681G probably benign Het
Mdga2 T C 12: 66,533,526 (GRCm39) N948D probably benign Het
Mettl4 A T 17: 95,041,061 (GRCm39) F364L probably damaging Het
Mosmo T C 7: 120,277,055 (GRCm39) I23T probably benign Het
Mtg1 G A 7: 139,723,657 (GRCm39) V96I probably benign Het
Myh11 T A 16: 14,036,803 (GRCm39) R966S possibly damaging Het
Ncapg2 A G 12: 116,388,337 (GRCm39) probably null Het
Nid1 G A 13: 13,683,353 (GRCm39) V1144I probably benign Het
Or4a77 T C 2: 89,486,910 (GRCm39) I292V probably benign Het
Or52a33 A T 7: 103,289,167 (GRCm39) M60K probably damaging Het
Or55b4 C A 7: 102,133,979 (GRCm39) C116F possibly damaging Het
Oscar T G 7: 3,614,238 (GRCm39) Y167S probably damaging Het
Pa2g4 T C 10: 128,396,559 (GRCm39) T200A probably benign Het
Pcdh7 A G 5: 57,877,126 (GRCm39) D227G probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Plce1 G A 19: 38,747,384 (GRCm39) G1702R probably damaging Het
Plxna2 C A 1: 194,476,212 (GRCm39) T1144K possibly damaging Het
Prl8a8 G A 13: 27,695,450 (GRCm39) T99I probably benign Het
Prr29 C A 11: 106,267,085 (GRCm39) H83Q probably damaging Het
Raly T A 2: 154,701,664 (GRCm39) I108N possibly damaging Het
Ranbp9 A T 13: 43,573,098 (GRCm39) S475R probably benign Het
Rogdi C A 16: 4,831,362 (GRCm39) probably benign Het
Rorc C T 3: 94,280,214 (GRCm39) Q6* probably null Het
Sacs T C 14: 61,449,945 (GRCm39) L3997S probably damaging Het
Scn2a A T 2: 65,594,950 (GRCm39) Y1933F probably benign Het
Sik3 T C 9: 46,122,041 (GRCm39) L898P probably damaging Het
Sipa1l1 A G 12: 82,388,180 (GRCm39) I135M probably damaging Het
Slc26a3 C A 12: 31,500,934 (GRCm39) Q224K probably damaging Het
Sobp G T 10: 42,897,436 (GRCm39) N716K probably benign Het
Spata16 A G 3: 26,981,483 (GRCm39) D513G probably damaging Het
Spata31h1 G A 10: 82,125,777 (GRCm39) T2411I probably damaging Het
Speer4a3 A T 5: 26,154,842 (GRCm39) S253T possibly damaging Het
Stac T C 9: 111,401,394 (GRCm39) R351G possibly damaging Het
Tecta T A 9: 42,306,237 (GRCm39) T64S probably benign Het
Tert G A 13: 73,776,529 (GRCm39) V427M probably damaging Het
Tex15 G A 8: 34,060,748 (GRCm39) M333I probably benign Het
Tmbim4 A T 10: 120,056,664 (GRCm39) Q72L probably benign Het
Trav9n-4 T C 14: 53,532,256 (GRCm39) S37P probably benign Het
Trpv5 A T 6: 41,652,894 (GRCm39) M93K possibly damaging Het
Ulk4 T C 9: 121,087,876 (GRCm39) E272G probably benign Het
Ulk4 T C 9: 121,095,583 (GRCm39) T79A probably benign Het
Upb1 A G 10: 75,248,602 (GRCm39) N41D probably benign Het
Wls A T 3: 159,639,965 (GRCm39) Y532F probably damaging Het
Zdhhc5 G A 2: 84,545,355 (GRCm39) probably benign Het
Zfp109 T C 7: 23,928,785 (GRCm39) D216G probably benign Het
Zfp473 G A 7: 44,381,798 (GRCm39) A845V probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73,036,461 (GRCm39) missense probably benign 0.17
IGL00472:Itgae APN 11 73,004,520 (GRCm39) missense probably benign 0.06
IGL00821:Itgae APN 11 73,013,974 (GRCm39) missense probably damaging 1.00
IGL01625:Itgae APN 11 73,010,263 (GRCm39) missense probably benign 0.00
IGL01639:Itgae APN 11 73,010,204 (GRCm39) missense probably benign 0.00
IGL01743:Itgae APN 11 73,002,585 (GRCm39) missense probably benign 0.02
IGL01911:Itgae APN 11 73,006,963 (GRCm39) missense probably damaging 1.00
IGL01949:Itgae APN 11 73,009,010 (GRCm39) missense probably benign 0.29
IGL02149:Itgae APN 11 72,994,720 (GRCm39) missense probably benign 0.04
IGL02179:Itgae APN 11 73,024,844 (GRCm39) missense probably benign 0.06
IGL02231:Itgae APN 11 72,981,448 (GRCm39) missense possibly damaging 0.88
IGL02292:Itgae APN 11 73,009,361 (GRCm39) missense probably damaging 0.98
IGL02378:Itgae APN 11 73,008,947 (GRCm39) missense probably benign 0.00
IGL02525:Itgae APN 11 73,021,777 (GRCm39) missense probably damaging 0.98
IGL02576:Itgae APN 11 73,009,331 (GRCm39) missense possibly damaging 0.95
IGL02729:Itgae APN 11 73,009,029 (GRCm39) splice site probably benign
IGL02859:Itgae APN 11 73,005,693 (GRCm39) missense probably damaging 1.00
IGL03074:Itgae APN 11 73,016,136 (GRCm39) missense probably benign 0.00
IGL03107:Itgae APN 11 73,004,427 (GRCm39) missense probably damaging 1.00
IGL03264:Itgae APN 11 73,006,400 (GRCm39) missense possibly damaging 0.73
IGL03272:Itgae APN 11 73,024,680 (GRCm39) splice site probably null
IGL03352:Itgae APN 11 73,022,556 (GRCm39) missense probably damaging 1.00
R0134:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0225:Itgae UTSW 11 73,002,168 (GRCm39) missense probably benign 0.00
R0320:Itgae UTSW 11 73,021,825 (GRCm39) missense possibly damaging 0.74
R0344:Itgae UTSW 11 73,008,973 (GRCm39) missense probably benign 0.13
R0403:Itgae UTSW 11 73,014,009 (GRCm39) missense possibly damaging 0.89
R0631:Itgae UTSW 11 73,005,733 (GRCm39) missense probably damaging 1.00
R0833:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0836:Itgae UTSW 11 73,020,032 (GRCm39) missense probably benign 0.02
R0973:Itgae UTSW 11 73,029,335 (GRCm39) nonsense probably null
R1231:Itgae UTSW 11 73,010,205 (GRCm39) missense probably benign 0.02
R1389:Itgae UTSW 11 73,016,188 (GRCm39) missense probably damaging 1.00
R1433:Itgae UTSW 11 73,006,418 (GRCm39) missense probably damaging 1.00
R1534:Itgae UTSW 11 73,036,431 (GRCm39) missense possibly damaging 0.58
R1833:Itgae UTSW 11 73,007,988 (GRCm39) missense possibly damaging 0.94
R1914:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R1915:Itgae UTSW 11 73,009,469 (GRCm39) splice site probably benign
R2061:Itgae UTSW 11 73,009,448 (GRCm39) missense probably benign 0.00
R2380:Itgae UTSW 11 73,036,395 (GRCm39) missense probably benign 0.00
R2435:Itgae UTSW 11 73,012,763 (GRCm39) nonsense probably null
R2680:Itgae UTSW 11 73,005,752 (GRCm39) missense probably damaging 1.00
R2886:Itgae UTSW 11 73,031,513 (GRCm39) missense probably benign 0.04
R3873:Itgae UTSW 11 73,004,442 (GRCm39) missense probably damaging 1.00
R3923:Itgae UTSW 11 73,006,969 (GRCm39) missense probably damaging 0.99
R4010:Itgae UTSW 11 73,002,165 (GRCm39) missense probably benign 0.00
R4059:Itgae UTSW 11 73,002,960 (GRCm39) missense probably benign
R4212:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4213:Itgae UTSW 11 73,010,178 (GRCm39) missense probably benign
R4691:Itgae UTSW 11 73,010,345 (GRCm39) nonsense probably null
R4736:Itgae UTSW 11 73,005,706 (GRCm39) missense possibly damaging 0.79
R5152:Itgae UTSW 11 73,021,821 (GRCm39) missense probably damaging 1.00
R5201:Itgae UTSW 11 73,001,382 (GRCm39) missense probably benign 0.00
R5307:Itgae UTSW 11 73,036,464 (GRCm39) missense probably benign 0.00
R5362:Itgae UTSW 11 73,002,675 (GRCm39) missense probably damaging 1.00
R5448:Itgae UTSW 11 73,024,734 (GRCm39) critical splice donor site probably null
R5645:Itgae UTSW 11 73,020,074 (GRCm39) missense probably damaging 1.00
R5672:Itgae UTSW 11 73,036,377 (GRCm39) missense possibly damaging 0.96
R6079:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6138:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
R6226:Itgae UTSW 11 73,031,583 (GRCm39) missense probably benign 0.11
R6244:Itgae UTSW 11 73,036,427 (GRCm39) missense probably damaging 0.96
R6326:Itgae UTSW 11 73,022,519 (GRCm39) missense possibly damaging 0.88
R6332:Itgae UTSW 11 73,002,228 (GRCm39) splice site probably null
R6502:Itgae UTSW 11 73,036,418 (GRCm39) missense probably benign 0.10
R6825:Itgae UTSW 11 73,009,322 (GRCm39) missense possibly damaging 0.89
R7016:Itgae UTSW 11 73,010,342 (GRCm39) missense probably damaging 0.99
R7020:Itgae UTSW 11 73,002,195 (GRCm39) missense probably damaging 1.00
R7132:Itgae UTSW 11 73,002,184 (GRCm39) missense possibly damaging 0.93
R7473:Itgae UTSW 11 73,031,504 (GRCm39) missense possibly damaging 0.87
R7599:Itgae UTSW 11 73,012,786 (GRCm39) missense possibly damaging 0.62
R7637:Itgae UTSW 11 73,004,457 (GRCm39) missense probably damaging 1.00
R7763:Itgae UTSW 11 73,014,095 (GRCm39) critical splice donor site probably null
R7829:Itgae UTSW 11 73,029,618 (GRCm39) missense probably benign
R7860:Itgae UTSW 11 73,011,099 (GRCm39) critical splice acceptor site probably null
R7978:Itgae UTSW 11 73,024,913 (GRCm39) missense probably damaging 0.98
R8197:Itgae UTSW 11 73,011,210 (GRCm39) missense probably benign
R8911:Itgae UTSW 11 73,004,447 (GRCm39) missense probably damaging 1.00
R9155:Itgae UTSW 11 73,016,089 (GRCm39) missense possibly damaging 0.94
R9284:Itgae UTSW 11 73,012,752 (GRCm39) missense probably benign 0.25
R9355:Itgae UTSW 11 73,006,906 (GRCm39) missense probably damaging 1.00
R9414:Itgae UTSW 11 73,002,629 (GRCm39) missense possibly damaging 0.59
R9595:Itgae UTSW 11 73,016,182 (GRCm39) missense probably damaging 0.99
R9618:Itgae UTSW 11 73,011,171 (GRCm39) missense possibly damaging 0.78
U15987:Itgae UTSW 11 73,006,400 (GRCm39) missense possibly damaging 0.73
X0024:Itgae UTSW 11 73,002,202 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1186:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1186:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1186:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1186:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1187:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1187:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1187:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1187:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1187:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1188:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1188:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1188:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1188:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1189:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1189:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1189:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1189:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1189:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1190:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1190:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1190:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1190:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1190:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Z1191:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1191:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1191:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1191:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1191:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,012,783 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,012,757 (GRCm39) missense probably benign 0.00
Z1192:Itgae UTSW 11 73,008,913 (GRCm39) missense probably benign 0.01
Z1192:Itgae UTSW 11 73,006,466 (GRCm39) missense probably benign
Z1192:Itgae UTSW 11 72,994,786 (GRCm39) missense probably damaging 1.00
Z1192:Itgae UTSW 11 72,994,713 (GRCm39) missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73,024,953 (GRCm39) missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGACTCTATGAAGCTCTGCTGAG -3'
(R):5'- TGTCCCAATCCTTTAAGCACAC -3'

Sequencing Primer
(F):5'- GTGCACTGTTCCTCCAAATAGCATAG -3'
(R):5'- CACAAGGTGACCTCCTATAATAAATC -3'
Posted On 2019-05-13