Incidental Mutation 'R7069:Itgae'
ID 548770
Institutional Source Beutler Lab
Gene Symbol Itgae
Ensembl Gene ENSMUSG00000005947
Gene Name integrin alpha E, epithelial-associated
Synonyms CD103, alpha-E1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 73090583-73147446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 73116143 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 405 (D405A)
Ref Sequence ENSEMBL: ENSMUSP00000006101 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006101] [ENSMUST00000102537]
AlphaFold Q60677
Predicted Effect probably damaging
Transcript: ENSMUST00000006101
AA Change: D405A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000006101
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 1e-24 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
transmembrane domain 1115 1137 N/A INTRINSIC
Pfam:Integrin_alpha 1138 1152 1.1e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102537
AA Change: D405A

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099596
Gene: ENSMUSG00000005947
AA Change: D405A

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:Int_alpha 36 118 5e-25 BLAST
VWA 193 380 1.13e-39 SMART
Int_alpha 448 496 1.49e-3 SMART
Int_alpha 502 559 6.83e-12 SMART
Int_alpha 565 626 1.79e-15 SMART
Int_alpha 633 685 6.29e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are heterodimeric integral membrane proteins composed of an alpha chain and a beta chain. This gene encodes an I-domain-containing alpha integrin that undergoes post-translational cleavage in the extracellular domain, yielding disulfide-linked heavy and light chains. In combination with the beta 7 integrin, this protein forms the E-cadherin binding integrin known as the human mucosal lymphocyte-1 antigen. This protein is preferentially expressed in human intestinal intraepithelial lymphocytes (IEL), and in addition to a role in adhesion, it may serve as an accessory molecule for IEL activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reductions in the numbers of intestinal and vaginal intraepithelial lymphocytes and of T lymphocytes of the lamina propria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,901 F97Y probably damaging Het
4932415D10Rik G A 10: 82,289,943 T2411I probably damaging Het
Aasdh T A 5: 76,876,356 I991L probably benign Het
Actg2 C A 6: 83,520,763 G96V probably damaging Het
Adh5 T A 3: 138,451,051 L166* probably null Het
Akap13 A G 7: 75,610,262 D75G probably benign Het
Ank2 T C 3: 126,946,298 probably benign Het
Arfgap1 T A 2: 180,974,120 D197E probably benign Het
Aste1 T C 9: 105,396,707 probably null Het
Atp8b2 T A 3: 89,954,571 N78I probably damaging Het
Btbd11 C A 10: 85,387,656 R110S unknown Het
Cacna2d3 T A 14: 28,969,303 probably benign Het
Chrd T A 16: 20,739,433 W809R probably damaging Het
Col2a1 C T 15: 97,998,588 G60D unknown Het
Coro7 T A 16: 4,679,611 M1L probably damaging Het
Dhx40 T C 11: 86,797,743 I285V probably benign Het
Dopey1 T C 9: 86,550,169 probably null Het
Enox1 A T 14: 77,611,324 R358S probably damaging Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Fam196b T A 11: 34,402,677 C240S possibly damaging Het
Fam221a A C 6: 49,378,498 Q178P probably damaging Het
Fcho1 A C 8: 71,710,497 probably null Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gal3st2b A T 1: 93,940,619 N189Y possibly damaging Het
Ghr T A 15: 3,320,484 D404V probably damaging Het
Glis3 A T 19: 28,531,519 V355D probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm21671 A T 5: 25,949,844 S253T possibly damaging Het
Gpr12 A C 5: 146,583,539 V32G possibly damaging Het
Gspt1 T A 16: 11,222,661 L593F probably damaging Het
H2-Q7 A T 17: 35,440,031 T153S probably damaging Het
Hars2 A G 18: 36,787,956 I194V probably damaging Het
Hdac9 T A 12: 34,429,549 T202S possibly damaging Het
Hoxd13 T C 2: 74,669,024 Y239H probably damaging Het
Insm2 C T 12: 55,599,836 Q122* probably null Het
Ip6k1 T A 9: 108,045,452 probably null Het
Ippk T C 13: 49,461,743 V534A probably damaging Het
Itch T G 2: 155,209,994 F611C probably damaging Het
Itga1 A T 13: 114,968,240 N1083K probably damaging Het
Kif18a T C 2: 109,295,002 S255P probably damaging Het
Klhl24 C G 16: 20,107,481 T253R probably benign Het
Krt81 T A 15: 101,460,728 T307S possibly damaging Het
Lbr A T 1: 181,828,789 W265R probably damaging Het
Lgals3bp T C 11: 118,393,173 T527A probably benign Het
Lzts1 A C 8: 69,140,745 V70G probably damaging Het
Map3k6 C T 4: 133,251,712 P1154S probably benign Het
Masp1 T C 16: 23,452,455 D681G probably benign Het
Mdga2 T C 12: 66,486,752 N948D probably benign Het
Mettl4 A T 17: 94,733,633 F364L probably damaging Het
Mosmo T C 7: 120,677,832 I23T probably benign Het
Mtg1 G A 7: 140,143,744 V96I probably benign Het
Myh11 T A 16: 14,218,939 R966S possibly damaging Het
Ncapg2 A G 12: 116,424,717 probably null Het
Nid1 G A 13: 13,508,768 V1144I probably benign Het
Olfr1250 T C 2: 89,656,566 I292V probably benign Het
Olfr544 C A 7: 102,484,772 C116F possibly damaging Het
Olfr622 A T 7: 103,639,960 M60K probably damaging Het
Oscar T G 7: 3,611,239 Y167S probably damaging Het
Pa2g4 T C 10: 128,560,690 T200A probably benign Het
Pcdh7 A G 5: 57,719,784 D227G probably benign Het
Plce1 G A 19: 38,758,940 G1702R probably damaging Het
Plxna2 C A 1: 194,793,904 T1144K possibly damaging Het
Prl8a8 G A 13: 27,511,467 T99I probably benign Het
Prr29 C A 11: 106,376,259 H83Q probably damaging Het
Raly T A 2: 154,859,744 I108N possibly damaging Het
Ranbp9 A T 13: 43,419,622 S475R probably benign Het
Rogdi C A 16: 5,013,498 probably benign Het
Rorc C T 3: 94,372,907 Q6* probably null Het
Sacs T C 14: 61,212,496 L3997S probably damaging Het
Scn2a A T 2: 65,764,606 Y1933F probably benign Het
Sik3 T C 9: 46,210,743 L898P probably damaging Het
Sipa1l1 A G 12: 82,341,406 I135M probably damaging Het
Slc26a3 C A 12: 31,450,935 Q224K probably damaging Het
Sobp G T 10: 43,021,440 N716K probably benign Het
Spata16 A G 3: 26,927,334 D513G probably damaging Het
Stac T C 9: 111,572,326 R351G possibly damaging Het
Tecta T A 9: 42,394,941 T64S probably benign Het
Tert G A 13: 73,628,410 V427M probably damaging Het
Tex15 G A 8: 33,570,720 M333I probably benign Het
Tmbim4 A T 10: 120,220,759 Q72L probably benign Het
Trav9n-4 T C 14: 53,294,799 S37P probably benign Het
Trpv5 A T 6: 41,675,960 M93K possibly damaging Het
Ulk4 T C 9: 121,258,810 E272G probably benign Het
Ulk4 T C 9: 121,266,517 T79A probably benign Het
Upb1 A G 10: 75,412,768 N41D probably benign Het
Wls A T 3: 159,934,329 Y532F probably damaging Het
Zdhhc5 G A 2: 84,715,011 probably benign Het
Zfp109 T C 7: 24,229,360 D216G probably benign Het
Zfp473 G A 7: 44,732,374 A845V probably damaging Het
Other mutations in Itgae
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00424:Itgae APN 11 73145635 missense probably benign 0.17
IGL00472:Itgae APN 11 73113694 missense probably benign 0.06
IGL00821:Itgae APN 11 73123148 missense probably damaging 1.00
IGL01625:Itgae APN 11 73119437 missense probably benign 0.00
IGL01639:Itgae APN 11 73119378 missense probably benign 0.00
IGL01743:Itgae APN 11 73111759 missense probably benign 0.02
IGL01911:Itgae APN 11 73116137 missense probably damaging 1.00
IGL01949:Itgae APN 11 73118184 missense probably benign 0.29
IGL02149:Itgae APN 11 73103894 missense probably benign 0.04
IGL02179:Itgae APN 11 73134018 missense probably benign 0.06
IGL02231:Itgae APN 11 73090622 missense possibly damaging 0.88
IGL02292:Itgae APN 11 73118535 missense probably damaging 0.98
IGL02378:Itgae APN 11 73118121 missense probably benign 0.00
IGL02525:Itgae APN 11 73130951 missense probably damaging 0.98
IGL02576:Itgae APN 11 73118505 missense possibly damaging 0.95
IGL02729:Itgae APN 11 73118203 splice site probably benign
IGL02859:Itgae APN 11 73114867 missense probably damaging 1.00
IGL03074:Itgae APN 11 73125310 missense probably benign 0.00
IGL03107:Itgae APN 11 73113601 missense probably damaging 1.00
IGL03264:Itgae APN 11 73115574 missense possibly damaging 0.73
IGL03272:Itgae APN 11 73133854 splice site probably null
IGL03352:Itgae APN 11 73131730 missense probably damaging 1.00
R0134:Itgae UTSW 11 73111342 missense probably benign 0.00
R0225:Itgae UTSW 11 73111342 missense probably benign 0.00
R0320:Itgae UTSW 11 73130999 missense possibly damaging 0.74
R0344:Itgae UTSW 11 73118147 missense probably benign 0.13
R0403:Itgae UTSW 11 73123183 missense possibly damaging 0.89
R0631:Itgae UTSW 11 73114907 missense probably damaging 1.00
R0833:Itgae UTSW 11 73129206 missense probably benign 0.02
R0836:Itgae UTSW 11 73129206 missense probably benign 0.02
R0973:Itgae UTSW 11 73138509 nonsense probably null
R1231:Itgae UTSW 11 73119379 missense probably benign 0.02
R1389:Itgae UTSW 11 73125362 missense probably damaging 1.00
R1433:Itgae UTSW 11 73115592 missense probably damaging 1.00
R1534:Itgae UTSW 11 73145605 missense possibly damaging 0.58
R1833:Itgae UTSW 11 73117162 missense possibly damaging 0.94
R1914:Itgae UTSW 11 73118643 splice site probably benign
R1915:Itgae UTSW 11 73118643 splice site probably benign
R2061:Itgae UTSW 11 73118622 missense probably benign 0.00
R2380:Itgae UTSW 11 73145569 missense probably benign 0.00
R2435:Itgae UTSW 11 73121937 nonsense probably null
R2680:Itgae UTSW 11 73114926 missense probably damaging 1.00
R2886:Itgae UTSW 11 73140687 missense probably benign 0.04
R3873:Itgae UTSW 11 73113616 missense probably damaging 1.00
R3923:Itgae UTSW 11 73116143 missense probably damaging 0.99
R4010:Itgae UTSW 11 73111339 missense probably benign 0.00
R4059:Itgae UTSW 11 73112134 missense probably benign
R4212:Itgae UTSW 11 73119352 missense probably benign
R4213:Itgae UTSW 11 73119352 missense probably benign
R4691:Itgae UTSW 11 73119519 nonsense probably null
R4736:Itgae UTSW 11 73114880 missense possibly damaging 0.79
R5152:Itgae UTSW 11 73130995 missense probably damaging 1.00
R5201:Itgae UTSW 11 73110556 missense probably benign 0.00
R5307:Itgae UTSW 11 73145638 missense probably benign 0.00
R5362:Itgae UTSW 11 73111849 missense probably damaging 1.00
R5448:Itgae UTSW 11 73133908 critical splice donor site probably null
R5645:Itgae UTSW 11 73129248 missense probably damaging 1.00
R5672:Itgae UTSW 11 73145551 missense possibly damaging 0.96
R6079:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6138:Itgae UTSW 11 73115574 missense possibly damaging 0.73
R6226:Itgae UTSW 11 73140757 missense probably benign 0.11
R6244:Itgae UTSW 11 73145601 missense probably damaging 0.96
R6326:Itgae UTSW 11 73131693 missense possibly damaging 0.88
R6332:Itgae UTSW 11 73111402 splice site probably null
R6502:Itgae UTSW 11 73145592 missense probably benign 0.10
R6825:Itgae UTSW 11 73118496 missense possibly damaging 0.89
R7016:Itgae UTSW 11 73119516 missense probably damaging 0.99
R7020:Itgae UTSW 11 73111369 missense probably damaging 1.00
R7132:Itgae UTSW 11 73111358 missense possibly damaging 0.93
R7473:Itgae UTSW 11 73140678 missense possibly damaging 0.87
R7599:Itgae UTSW 11 73121960 missense possibly damaging 0.62
R7637:Itgae UTSW 11 73113631 missense probably damaging 1.00
R7763:Itgae UTSW 11 73123269 critical splice donor site probably null
R7829:Itgae UTSW 11 73138792 missense probably benign
R7860:Itgae UTSW 11 73120273 critical splice acceptor site probably null
R7978:Itgae UTSW 11 73134087 missense probably damaging 0.98
R8197:Itgae UTSW 11 73120384 missense probably benign
R8911:Itgae UTSW 11 73113621 missense probably damaging 1.00
R9155:Itgae UTSW 11 73125263 missense possibly damaging 0.94
R9284:Itgae UTSW 11 73121926 missense probably benign 0.25
R9355:Itgae UTSW 11 73116080 missense probably damaging 1.00
R9414:Itgae UTSW 11 73111803 missense possibly damaging 0.59
R9595:Itgae UTSW 11 73125356 missense probably damaging 0.99
R9618:Itgae UTSW 11 73120345 missense possibly damaging 0.78
U15987:Itgae UTSW 11 73115574 missense possibly damaging 0.73
X0024:Itgae UTSW 11 73111376 missense probably benign 0.01
Z1186:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1186:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1186:Itgae UTSW 11 73115640 missense probably benign
Z1186:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1186:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1186:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1186:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1187:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1187:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1187:Itgae UTSW 11 73115640 missense probably benign
Z1187:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1187:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1187:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1187:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1188:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1188:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1188:Itgae UTSW 11 73115640 missense probably benign
Z1188:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1188:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1188:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1188:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1189:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1189:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1189:Itgae UTSW 11 73115640 missense probably benign
Z1189:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1189:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1189:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1189:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1190:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1190:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1190:Itgae UTSW 11 73115640 missense probably benign
Z1190:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1190:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1190:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1190:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1191:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1191:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1191:Itgae UTSW 11 73115640 missense probably benign
Z1191:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1191:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1191:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1191:Itgae UTSW 11 73134127 missense probably benign 0.36
Z1192:Itgae UTSW 11 73103887 missense possibly damaging 0.74
Z1192:Itgae UTSW 11 73103960 missense probably damaging 1.00
Z1192:Itgae UTSW 11 73115640 missense probably benign
Z1192:Itgae UTSW 11 73118087 missense probably benign 0.01
Z1192:Itgae UTSW 11 73121931 missense probably benign 0.00
Z1192:Itgae UTSW 11 73121957 missense probably benign 0.00
Z1192:Itgae UTSW 11 73134127 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- TGACTCTATGAAGCTCTGCTGAG -3'
(R):5'- TGTCCCAATCCTTTAAGCACAC -3'

Sequencing Primer
(F):5'- GTGCACTGTTCCTCCAAATAGCATAG -3'
(R):5'- CACAAGGTGACCTCCTATAATAAATC -3'
Posted On 2019-05-13