Incidental Mutation 'R7069:Dhx40'
ID 548771
Institutional Source Beutler Lab
Gene Symbol Dhx40
Ensembl Gene ENSMUSG00000018425
Gene Name DEAH (Asp-Glu-Ala-His) box polypeptide 40
Synonyms ARG147, 2410016C14Rik, DDX40
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 86768846-86807746 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86797743 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 285 (I285V)
Ref Sequence ENSEMBL: ENSMUSP00000018569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]
AlphaFold Q6PE54
Predicted Effect probably benign
Transcript: ENSMUST00000018569
AA Change: I285V

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425
AA Change: I285V

DomainStartEndE-ValueType
DEXDc 47 240 6.32e-33 SMART
HELICc 283 401 3.08e-13 SMART
HA2 462 557 1.92e-21 SMART
Pfam:OB_NTP_bind 588 699 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148263
SMART Domains Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425

DomainStartEndE-ValueType
Blast:DEXDc 1 96 3e-60 BLAST
SCOP:d1a1va1 4 59 5e-7 SMART
HA2 164 259 1.92e-21 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,901 F97Y probably damaging Het
4932415D10Rik G A 10: 82,289,943 T2411I probably damaging Het
Aasdh T A 5: 76,876,356 I991L probably benign Het
Actg2 C A 6: 83,520,763 G96V probably damaging Het
Adh5 T A 3: 138,451,051 L166* probably null Het
Akap13 A G 7: 75,610,262 D75G probably benign Het
Ank2 T C 3: 126,946,298 probably benign Het
Arfgap1 T A 2: 180,974,120 D197E probably benign Het
Aste1 T C 9: 105,396,707 probably null Het
Atp8b2 T A 3: 89,954,571 N78I probably damaging Het
Btbd11 C A 10: 85,387,656 R110S unknown Het
Cacna2d3 T A 14: 28,969,303 probably benign Het
Chrd T A 16: 20,739,433 W809R probably damaging Het
Col2a1 C T 15: 97,998,588 G60D unknown Het
Coro7 T A 16: 4,679,611 M1L probably damaging Het
Dopey1 T C 9: 86,550,169 probably null Het
Enox1 A T 14: 77,611,324 R358S probably damaging Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Fam196b T A 11: 34,402,677 C240S possibly damaging Het
Fam221a A C 6: 49,378,498 Q178P probably damaging Het
Fcho1 A C 8: 71,710,497 probably null Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gal3st2b A T 1: 93,940,619 N189Y possibly damaging Het
Ghr T A 15: 3,320,484 D404V probably damaging Het
Glis3 A T 19: 28,531,519 V355D probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm21671 A T 5: 25,949,844 S253T possibly damaging Het
Gpr12 A C 5: 146,583,539 V32G possibly damaging Het
Gspt1 T A 16: 11,222,661 L593F probably damaging Het
H2-Q7 A T 17: 35,440,031 T153S probably damaging Het
Hars2 A G 18: 36,787,956 I194V probably damaging Het
Hdac9 T A 12: 34,429,549 T202S possibly damaging Het
Hoxd13 T C 2: 74,669,024 Y239H probably damaging Het
Insm2 C T 12: 55,599,836 Q122* probably null Het
Ip6k1 T A 9: 108,045,452 probably null Het
Ippk T C 13: 49,461,743 V534A probably damaging Het
Itch T G 2: 155,209,994 F611C probably damaging Het
Itga1 A T 13: 114,968,240 N1083K probably damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kif18a T C 2: 109,295,002 S255P probably damaging Het
Klhl24 C G 16: 20,107,481 T253R probably benign Het
Krt81 T A 15: 101,460,728 T307S possibly damaging Het
Lbr A T 1: 181,828,789 W265R probably damaging Het
Lgals3bp T C 11: 118,393,173 T527A probably benign Het
Lzts1 A C 8: 69,140,745 V70G probably damaging Het
Map3k6 C T 4: 133,251,712 P1154S probably benign Het
Masp1 T C 16: 23,452,455 D681G probably benign Het
Mdga2 T C 12: 66,486,752 N948D probably benign Het
Mettl4 A T 17: 94,733,633 F364L probably damaging Het
Mosmo T C 7: 120,677,832 I23T probably benign Het
Mtg1 G A 7: 140,143,744 V96I probably benign Het
Myh11 T A 16: 14,218,939 R966S possibly damaging Het
Ncapg2 A G 12: 116,424,717 probably null Het
Nid1 G A 13: 13,508,768 V1144I probably benign Het
Olfr1250 T C 2: 89,656,566 I292V probably benign Het
Olfr544 C A 7: 102,484,772 C116F possibly damaging Het
Olfr622 A T 7: 103,639,960 M60K probably damaging Het
Oscar T G 7: 3,611,239 Y167S probably damaging Het
Pa2g4 T C 10: 128,560,690 T200A probably benign Het
Pcdh7 A G 5: 57,719,784 D227G probably benign Het
Plce1 G A 19: 38,758,940 G1702R probably damaging Het
Plxna2 C A 1: 194,793,904 T1144K possibly damaging Het
Prl8a8 G A 13: 27,511,467 T99I probably benign Het
Prr29 C A 11: 106,376,259 H83Q probably damaging Het
Raly T A 2: 154,859,744 I108N possibly damaging Het
Ranbp9 A T 13: 43,419,622 S475R probably benign Het
Rogdi C A 16: 5,013,498 probably benign Het
Rorc C T 3: 94,372,907 Q6* probably null Het
Sacs T C 14: 61,212,496 L3997S probably damaging Het
Scn2a A T 2: 65,764,606 Y1933F probably benign Het
Sik3 T C 9: 46,210,743 L898P probably damaging Het
Sipa1l1 A G 12: 82,341,406 I135M probably damaging Het
Slc26a3 C A 12: 31,450,935 Q224K probably damaging Het
Sobp G T 10: 43,021,440 N716K probably benign Het
Spata16 A G 3: 26,927,334 D513G probably damaging Het
Stac T C 9: 111,572,326 R351G possibly damaging Het
Tecta T A 9: 42,394,941 T64S probably benign Het
Tert G A 13: 73,628,410 V427M probably damaging Het
Tex15 G A 8: 33,570,720 M333I probably benign Het
Tmbim4 A T 10: 120,220,759 Q72L probably benign Het
Trav9n-4 T C 14: 53,294,799 S37P probably benign Het
Trpv5 A T 6: 41,675,960 M93K possibly damaging Het
Ulk4 T C 9: 121,258,810 E272G probably benign Het
Ulk4 T C 9: 121,266,517 T79A probably benign Het
Upb1 A G 10: 75,412,768 N41D probably benign Het
Wls A T 3: 159,934,329 Y532F probably damaging Het
Zdhhc5 G A 2: 84,715,011 probably benign Het
Zfp109 T C 7: 24,229,360 D216G probably benign Het
Zfp473 G A 7: 44,732,374 A845V probably damaging Het
Other mutations in Dhx40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Dhx40 APN 11 86776702 missense probably damaging 0.98
IGL02818:Dhx40 APN 11 86799505 missense probably benign 0.26
IGL02932:Dhx40 APN 11 86771929 missense probably damaging 1.00
R0312:Dhx40 UTSW 11 86771949 missense probably damaging 0.99
R0485:Dhx40 UTSW 11 86771262 unclassified probably benign
R0542:Dhx40 UTSW 11 86804256 critical splice donor site probably null
R0565:Dhx40 UTSW 11 86771167 missense probably damaging 0.97
R1218:Dhx40 UTSW 11 86799484 missense probably benign 0.13
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1544:Dhx40 UTSW 11 86806553 missense possibly damaging 0.93
R1550:Dhx40 UTSW 11 86776739 splice site probably null
R1839:Dhx40 UTSW 11 86789297 missense possibly damaging 0.46
R2923:Dhx40 UTSW 11 86789263 missense probably benign 0.26
R3743:Dhx40 UTSW 11 86771159 missense probably damaging 0.99
R3864:Dhx40 UTSW 11 86789245 missense possibly damaging 0.85
R4902:Dhx40 UTSW 11 86771210 missense possibly damaging 0.95
R4918:Dhx40 UTSW 11 86804391 missense possibly damaging 0.85
R5119:Dhx40 UTSW 11 86776636 missense probably damaging 0.99
R5416:Dhx40 UTSW 11 86797691 missense probably benign 0.01
R5531:Dhx40 UTSW 11 86789504 missense possibly damaging 0.45
R5677:Dhx40 UTSW 11 86800963 splice site probably null
R6270:Dhx40 UTSW 11 86799605 missense possibly damaging 0.85
R6431:Dhx40 UTSW 11 86773823 missense probably damaging 0.97
R6456:Dhx40 UTSW 11 86784974 missense probably damaging 1.00
R6594:Dhx40 UTSW 11 86785773 missense possibly damaging 0.74
R6599:Dhx40 UTSW 11 86804349 missense possibly damaging 0.51
R7268:Dhx40 UTSW 11 86806616 missense possibly damaging 0.86
R7470:Dhx40 UTSW 11 86776702 missense probably damaging 0.98
R7632:Dhx40 UTSW 11 86799437 missense probably benign 0.42
R7728:Dhx40 UTSW 11 86771933 missense probably damaging 0.98
R7788:Dhx40 UTSW 11 86775676 missense possibly damaging 0.86
R7869:Dhx40 UTSW 11 86797706 missense probably benign 0.02
R7889:Dhx40 UTSW 11 86798967 missense probably benign 0.01
R8046:Dhx40 UTSW 11 86784940 nonsense probably null
R8380:Dhx40 UTSW 11 86806585 missense probably damaging 1.00
R8691:Dhx40 UTSW 11 86799593 missense possibly damaging 0.63
R8992:Dhx40 UTSW 11 86776756 intron probably benign
R9153:Dhx40 UTSW 11 86799539 missense probably damaging 0.97
R9157:Dhx40 UTSW 11 86771224 missense probably damaging 0.98
R9277:Dhx40 UTSW 11 86770230 missense probably benign 0.33
X0021:Dhx40 UTSW 11 86773814 missense possibly damaging 0.84
X0066:Dhx40 UTSW 11 86806502 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AACTCTTTACTGGCCAGTCATG -3'
(R):5'- TGGTATTAACAGCATGAAAGGCTTG -3'

Sequencing Primer
(F):5'- CAGTCATGTTTTCTTTCCTAGTAAGG -3'
(R):5'- TGTTTAGAAGTCAGAAACATCTGC -3'
Posted On 2019-05-13