Incidental Mutation 'R7069:Masp1'
ID 548798
Institutional Source Beutler Lab
Gene Symbol Masp1
Ensembl Gene ENSMUSG00000022887
Gene Name MBL associated serine protease 1
Synonyms Crarf
MMRRC Submission 045165-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.164) question?
Stock # R7069 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 23268167-23339565 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 23271205 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 681 (D681G)
Ref Sequence ENSEMBL: ENSMUSP00000087327 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089883]
AlphaFold P98064
Predicted Effect probably benign
Transcript: ENSMUST00000089883
AA Change: D681G

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000087327
Gene: ENSMUSG00000022887
AA Change: D681G

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
CUB 23 143 2.96e-36 SMART
EGF_CA 144 187 1.46e-7 SMART
CUB 190 302 1.49e-41 SMART
CCP 306 367 4.41e-12 SMART
CCP 372 437 3.05e-6 SMART
Tryp_SPc 453 696 4.66e-84 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele display decreased survivor rate, reduced body weight, and impaired activation of the lectin and alternative complement pathways. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(1) Gene trapped(1)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdh T A 5: 77,024,203 (GRCm39) I991L probably benign Het
Abtb3 C A 10: 85,223,520 (GRCm39) R110S unknown Het
Actg2 C A 6: 83,497,745 (GRCm39) G96V probably damaging Het
Adh5 T A 3: 138,156,812 (GRCm39) L166* probably null Het
Akap13 A G 7: 75,260,010 (GRCm39) D75G probably benign Het
Ank2 T C 3: 126,739,947 (GRCm39) probably benign Het
Arfgap1 T A 2: 180,615,913 (GRCm39) D197E probably benign Het
Aste1 T C 9: 105,273,906 (GRCm39) probably null Het
Atp8b2 T A 3: 89,861,878 (GRCm39) N78I probably damaging Het
Cacna2d3 T A 14: 28,691,260 (GRCm39) probably benign Het
Chrd T A 16: 20,558,183 (GRCm39) W809R probably damaging Het
Col2a1 C T 15: 97,896,469 (GRCm39) G60D unknown Het
Coro7 T A 16: 4,497,475 (GRCm39) M1L probably damaging Het
Cracdl A T 1: 37,670,982 (GRCm39) F97Y probably damaging Het
Dhx40 T C 11: 86,688,569 (GRCm39) I285V probably benign Het
Dop1a T C 9: 86,432,222 (GRCm39) probably null Het
Enox1 A T 14: 77,848,764 (GRCm39) R358S probably damaging Het
Ep400 A G 5: 110,815,990 (GRCm39) V2724A probably damaging Het
Fam221a A C 6: 49,355,432 (GRCm39) Q178P probably damaging Het
Fcho1 A C 8: 72,163,141 (GRCm39) probably null Het
Fndc1 A T 17: 7,988,567 (GRCm39) V1165D unknown Het
Gal3st2b A T 1: 93,868,341 (GRCm39) N189Y possibly damaging Het
Ghr T A 15: 3,349,966 (GRCm39) D404V probably damaging Het
Glis3 A T 19: 28,508,919 (GRCm39) V355D probably damaging Het
Gpr12 A C 5: 146,520,349 (GRCm39) V32G possibly damaging Het
Gspt1 T A 16: 11,040,525 (GRCm39) L593F probably damaging Het
H2-Q7 A T 17: 35,659,007 (GRCm39) T153S probably damaging Het
Hars2 A G 18: 36,921,009 (GRCm39) I194V probably damaging Het
Hdac9 T A 12: 34,479,548 (GRCm39) T202S possibly damaging Het
Hoxd13 T C 2: 74,499,368 (GRCm39) Y239H probably damaging Het
Insm2 C T 12: 55,646,621 (GRCm39) Q122* probably null Het
Insyn2b T A 11: 34,352,677 (GRCm39) C240S possibly damaging Het
Ip6k1 T A 9: 107,922,651 (GRCm39) probably null Het
Ippk T C 13: 49,615,219 (GRCm39) V534A probably damaging Het
Itch T G 2: 155,051,914 (GRCm39) F611C probably damaging Het
Itga1 A T 13: 115,104,776 (GRCm39) N1083K probably damaging Het
Itgae A C 11: 73,006,969 (GRCm39) D405A probably damaging Het
Kif18a T C 2: 109,125,347 (GRCm39) S255P probably damaging Het
Klhl24 C G 16: 19,926,231 (GRCm39) T253R probably benign Het
Krt81 T A 15: 101,358,609 (GRCm39) T307S possibly damaging Het
Lbr A T 1: 181,656,354 (GRCm39) W265R probably damaging Het
Lgals3bp T C 11: 118,283,999 (GRCm39) T527A probably benign Het
Lzts1 A C 8: 69,593,397 (GRCm39) V70G probably damaging Het
Map3k6 C T 4: 132,979,023 (GRCm39) P1154S probably benign Het
Mdga2 T C 12: 66,533,526 (GRCm39) N948D probably benign Het
Mettl4 A T 17: 95,041,061 (GRCm39) F364L probably damaging Het
Mosmo T C 7: 120,277,055 (GRCm39) I23T probably benign Het
Mtg1 G A 7: 139,723,657 (GRCm39) V96I probably benign Het
Myh11 T A 16: 14,036,803 (GRCm39) R966S possibly damaging Het
Ncapg2 A G 12: 116,388,337 (GRCm39) probably null Het
Nid1 G A 13: 13,683,353 (GRCm39) V1144I probably benign Het
Or4a77 T C 2: 89,486,910 (GRCm39) I292V probably benign Het
Or52a33 A T 7: 103,289,167 (GRCm39) M60K probably damaging Het
Or55b4 C A 7: 102,133,979 (GRCm39) C116F possibly damaging Het
Oscar T G 7: 3,614,238 (GRCm39) Y167S probably damaging Het
Pa2g4 T C 10: 128,396,559 (GRCm39) T200A probably benign Het
Pcdh7 A G 5: 57,877,126 (GRCm39) D227G probably benign Het
Pira1 C G 7: 3,740,319 (GRCm39) A301P probably damaging Het
Plce1 G A 19: 38,747,384 (GRCm39) G1702R probably damaging Het
Plxna2 C A 1: 194,476,212 (GRCm39) T1144K possibly damaging Het
Prl8a8 G A 13: 27,695,450 (GRCm39) T99I probably benign Het
Prr29 C A 11: 106,267,085 (GRCm39) H83Q probably damaging Het
Raly T A 2: 154,701,664 (GRCm39) I108N possibly damaging Het
Ranbp9 A T 13: 43,573,098 (GRCm39) S475R probably benign Het
Rogdi C A 16: 4,831,362 (GRCm39) probably benign Het
Rorc C T 3: 94,280,214 (GRCm39) Q6* probably null Het
Sacs T C 14: 61,449,945 (GRCm39) L3997S probably damaging Het
Scn2a A T 2: 65,594,950 (GRCm39) Y1933F probably benign Het
Sik3 T C 9: 46,122,041 (GRCm39) L898P probably damaging Het
Sipa1l1 A G 12: 82,388,180 (GRCm39) I135M probably damaging Het
Slc26a3 C A 12: 31,500,934 (GRCm39) Q224K probably damaging Het
Sobp G T 10: 42,897,436 (GRCm39) N716K probably benign Het
Spata16 A G 3: 26,981,483 (GRCm39) D513G probably damaging Het
Spata31h1 G A 10: 82,125,777 (GRCm39) T2411I probably damaging Het
Speer4a3 A T 5: 26,154,842 (GRCm39) S253T possibly damaging Het
Stac T C 9: 111,401,394 (GRCm39) R351G possibly damaging Het
Tecta T A 9: 42,306,237 (GRCm39) T64S probably benign Het
Tert G A 13: 73,776,529 (GRCm39) V427M probably damaging Het
Tex15 G A 8: 34,060,748 (GRCm39) M333I probably benign Het
Tmbim4 A T 10: 120,056,664 (GRCm39) Q72L probably benign Het
Trav9n-4 T C 14: 53,532,256 (GRCm39) S37P probably benign Het
Trpv5 A T 6: 41,652,894 (GRCm39) M93K possibly damaging Het
Ulk4 T C 9: 121,087,876 (GRCm39) E272G probably benign Het
Ulk4 T C 9: 121,095,583 (GRCm39) T79A probably benign Het
Upb1 A G 10: 75,248,602 (GRCm39) N41D probably benign Het
Wls A T 3: 159,639,965 (GRCm39) Y532F probably damaging Het
Zdhhc5 G A 2: 84,545,355 (GRCm39) probably benign Het
Zfp109 T C 7: 23,928,785 (GRCm39) D216G probably benign Het
Zfp473 G A 7: 44,381,798 (GRCm39) A845V probably damaging Het
Other mutations in Masp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Masp1 APN 16 23,276,841 (GRCm39) missense possibly damaging 0.93
IGL00428:Masp1 APN 16 23,295,062 (GRCm39) missense probably damaging 1.00
IGL00432:Masp1 APN 16 23,332,601 (GRCm39) missense probably damaging 1.00
IGL02598:Masp1 APN 16 23,278,381 (GRCm39) missense probably benign
IGL02718:Masp1 APN 16 23,295,043 (GRCm39) missense probably damaging 1.00
IGL02947:Masp1 APN 16 23,313,476 (GRCm39) missense probably damaging 0.99
A4554:Masp1 UTSW 16 23,273,690 (GRCm39) splice site probably null
PIT1430001:Masp1 UTSW 16 23,332,694 (GRCm39) missense probably damaging 1.00
R0103:Masp1 UTSW 16 23,276,768 (GRCm39) missense probably damaging 1.00
R0505:Masp1 UTSW 16 23,276,888 (GRCm39) missense probably benign
R0630:Masp1 UTSW 16 23,271,169 (GRCm39) missense probably benign 0.01
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1146:Masp1 UTSW 16 23,310,865 (GRCm39) missense probably damaging 1.00
R1339:Masp1 UTSW 16 23,271,217 (GRCm39) missense probably damaging 1.00
R1521:Masp1 UTSW 16 23,313,387 (GRCm39) missense probably damaging 1.00
R1588:Masp1 UTSW 16 23,313,404 (GRCm39) missense probably damaging 1.00
R1961:Masp1 UTSW 16 23,271,682 (GRCm39) missense probably damaging 1.00
R1986:Masp1 UTSW 16 23,302,211 (GRCm39) missense probably benign 0.01
R2080:Masp1 UTSW 16 23,310,709 (GRCm39) missense probably damaging 1.00
R2215:Masp1 UTSW 16 23,271,271 (GRCm39) missense possibly damaging 0.92
R2216:Masp1 UTSW 16 23,310,805 (GRCm39) missense probably benign 0.00
R2443:Masp1 UTSW 16 23,295,062 (GRCm39) missense probably damaging 1.00
R4934:Masp1 UTSW 16 23,283,826 (GRCm39) missense probably damaging 0.98
R5224:Masp1 UTSW 16 23,313,445 (GRCm39) missense probably damaging 1.00
R5340:Masp1 UTSW 16 23,276,858 (GRCm39) missense probably damaging 1.00
R5562:Masp1 UTSW 16 23,283,917 (GRCm39) splice site probably null
R5663:Masp1 UTSW 16 23,271,688 (GRCm39) missense possibly damaging 0.57
R5742:Masp1 UTSW 16 23,273,675 (GRCm39) missense probably benign 0.01
R5763:Masp1 UTSW 16 23,314,997 (GRCm39) missense probably damaging 1.00
R5898:Masp1 UTSW 16 23,310,677 (GRCm39) missense probably damaging 0.99
R6901:Masp1 UTSW 16 23,332,584 (GRCm39) missense probably damaging 0.99
R6987:Masp1 UTSW 16 23,332,665 (GRCm39) missense probably damaging 1.00
R7356:Masp1 UTSW 16 23,288,993 (GRCm39) missense possibly damaging 0.50
R7512:Masp1 UTSW 16 23,288,874 (GRCm39) missense probably damaging 1.00
R7539:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R7810:Masp1 UTSW 16 23,295,068 (GRCm39) missense probably benign 0.01
R8026:Masp1 UTSW 16 23,303,156 (GRCm39) missense probably damaging 1.00
R8391:Masp1 UTSW 16 23,289,128 (GRCm39) missense possibly damaging 0.94
R8438:Masp1 UTSW 16 23,289,153 (GRCm39) missense probably benign 0.38
R8475:Masp1 UTSW 16 23,271,281 (GRCm39) missense probably damaging 0.99
R8870:Masp1 UTSW 16 23,314,882 (GRCm39) missense probably damaging 1.00
R9052:Masp1 UTSW 16 23,339,350 (GRCm39) start gained probably benign
R9072:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9073:Masp1 UTSW 16 23,288,671 (GRCm39) missense probably benign 0.07
R9599:Masp1 UTSW 16 23,271,698 (GRCm39) missense probably benign 0.16
R9686:Masp1 UTSW 16 23,314,887 (GRCm39) missense probably damaging 1.00
X0065:Masp1 UTSW 16 23,332,719 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATCACCCAGGAATGAGCAGTG -3'
(R):5'- CCTCCAGTGGCTAATTGTCTG -3'

Sequencing Primer
(F):5'- CCCAGGAATGAGCAGTGAAGAC -3'
(R):5'- CCAGTGGCTAATTGTCTGAACTAC -3'
Posted On 2019-05-13