Incidental Mutation 'R7069:Plce1'
ID548804
Institutional Source Beutler Lab
Gene Symbol Plce1
Ensembl Gene ENSMUSG00000024998
Gene Namephospholipase C, epsilon 1
Synonyms4933403A21Rik, PLCepsilon
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.559) question?
Stock #R7069 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location38481109-38785030 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38758940 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 1702 (G1702R)
Ref Sequence ENSEMBL: ENSMUSP00000138360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169713] [ENSMUST00000182267] [ENSMUST00000182481]
Predicted Effect probably damaging
Transcript: ENSMUST00000169713
AA Change: G1702R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130604
Gene: ENSMUSG00000024998
AA Change: G1702R

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 7.6e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182267
AA Change: G1716R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000138330
Gene: ENSMUSG00000024998
AA Change: G1716R

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 5.9e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1552 1581 N/A INTRINSIC
SCOP:d1qasa3 1648 1676 1e-3 SMART
low complexity region 1680 1694 N/A INTRINSIC
PLCYc 1724 1840 4.28e-46 SMART
C2 1864 1962 3.7e-10 SMART
PDB:2BYE|A 2000 2108 6e-47 PDB
RA 2129 2232 1.12e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000182481
AA Change: G1702R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138360
Gene: ENSMUSG00000024998
AA Change: G1702R

DomainStartEndE-ValueType
low complexity region 471 489 N/A INTRINSIC
RasGEF 525 828 8.06e-9 SMART
low complexity region 1162 1172 N/A INTRINSIC
Pfam:EF-hand_like 1305 1369 8e-11 PFAM
PLCXc 1373 1521 1.05e-81 SMART
low complexity region 1561 1575 N/A INTRINSIC
SCOP:d1qasa3 1634 1662 1e-3 SMART
low complexity region 1666 1680 N/A INTRINSIC
PLCYc 1710 1826 4.28e-46 SMART
C2 1850 1948 3.7e-10 SMART
PDB:2BYE|A 1986 2094 6e-47 PDB
RA 2115 2218 1.12e-2 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 98% (86/88)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phospholipase enzyme that catalyzes the hydrolysis of phosphatidylinositol-4,5-bisphosphate to generate two second messengers: inositol 1,4,5-triphosphate (IP3) and diacylglycerol (DAG). These second messengers subsequently regulate various processes affecting cell growth, differentiation, and gene expression. This enzyme is regulated by small monomeric GTPases of the Ras and Rho families and by heterotrimeric G proteins. In addition to its phospholipase C catalytic activity, this enzyme has an N-terminal domain with guanine nucleotide exchange (GEF) activity. Mutations in this gene cause early-onset nephrotic syndrome; characterized by proteinuria, edema, and diffuse mesangial sclerosis or focal and segmental glomerulosclerosis. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous mutation of this gene results in a congenital semilunar valvulogenesis defect which causes regurgitation and stenosis, and decreased incidence of induced skin tumors. Another mutant exhibits decreased cardiac contraction and increased hypertrophy in response to chronic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,631,901 F97Y probably damaging Het
4932415D10Rik G A 10: 82,289,943 T2411I probably damaging Het
Aasdh T A 5: 76,876,356 I991L probably benign Het
Actg2 C A 6: 83,520,763 G96V probably damaging Het
Adh5 T A 3: 138,451,051 L166* probably null Het
Akap13 A G 7: 75,610,262 D75G probably benign Het
Ank2 T C 3: 126,946,298 probably benign Het
Arfgap1 T A 2: 180,974,120 D197E probably benign Het
Aste1 T C 9: 105,396,707 probably null Het
Atp8b2 T A 3: 89,954,571 N78I probably damaging Het
Btbd11 C A 10: 85,387,656 R110S unknown Het
Cacna2d3 T A 14: 28,969,303 probably benign Het
Chrd T A 16: 20,739,433 W809R probably damaging Het
Col2a1 C T 15: 97,998,588 G60D unknown Het
Coro7 T A 16: 4,679,611 M1L probably damaging Het
Dhx40 T C 11: 86,797,743 I285V probably benign Het
Dopey1 T C 9: 86,550,169 probably null Het
Enox1 A T 14: 77,611,324 R358S probably damaging Het
Ep400 A G 5: 110,668,124 V2724A probably damaging Het
Fam196b T A 11: 34,402,677 C240S possibly damaging Het
Fam221a A C 6: 49,378,498 Q178P probably damaging Het
Fcho1 A C 8: 71,710,497 probably null Het
Fndc1 A T 17: 7,769,735 V1165D unknown Het
Gal3st2b A T 1: 93,940,619 N189Y possibly damaging Het
Ghr T A 15: 3,320,484 D404V probably damaging Het
Glis3 A T 19: 28,531,519 V355D probably damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm21671 A T 5: 25,949,844 S253T possibly damaging Het
Gpr12 A C 5: 146,583,539 V32G possibly damaging Het
Gspt1 T A 16: 11,222,661 L593F probably damaging Het
H2-Q7 A T 17: 35,440,031 T153S probably damaging Het
Hars2 A G 18: 36,787,956 I194V probably damaging Het
Hdac9 T A 12: 34,429,549 T202S possibly damaging Het
Hoxd13 T C 2: 74,669,024 Y239H probably damaging Het
Insm2 C T 12: 55,599,836 Q122* probably null Het
Ip6k1 T A 9: 108,045,452 probably null Het
Ippk T C 13: 49,461,743 V534A probably damaging Het
Itch T G 2: 155,209,994 F611C probably damaging Het
Itga1 A T 13: 114,968,240 N1083K probably damaging Het
Itgae A C 11: 73,116,143 D405A probably damaging Het
Kif18a T C 2: 109,295,002 S255P probably damaging Het
Klhl24 C G 16: 20,107,481 T253R probably benign Het
Krt81 T A 15: 101,460,728 T307S possibly damaging Het
Lbr A T 1: 181,828,789 W265R probably damaging Het
Lgals3bp T C 11: 118,393,173 T527A probably benign Het
Lzts1 A C 8: 69,140,745 V70G probably damaging Het
Map3k6 C T 4: 133,251,712 P1154S probably benign Het
Masp1 T C 16: 23,452,455 D681G probably benign Het
Mdga2 T C 12: 66,486,752 N948D probably benign Het
Mettl4 A T 17: 94,733,633 F364L probably damaging Het
Mosmo T C 7: 120,677,832 I23T probably benign Het
Mtg1 G A 7: 140,143,744 V96I probably benign Het
Myh11 T A 16: 14,218,939 R966S possibly damaging Het
Ncapg2 A G 12: 116,424,717 probably null Het
Nid1 G A 13: 13,508,768 V1144I probably benign Het
Olfr1250 T C 2: 89,656,566 I292V probably benign Het
Olfr544 C A 7: 102,484,772 C116F possibly damaging Het
Olfr622 A T 7: 103,639,960 M60K probably damaging Het
Oscar T G 7: 3,611,239 Y167S probably damaging Het
Pa2g4 T C 10: 128,560,690 T200A probably benign Het
Pcdh7 A G 5: 57,719,784 D227G probably benign Het
Plxna2 C A 1: 194,793,904 T1144K possibly damaging Het
Prl8a8 G A 13: 27,511,467 T99I probably benign Het
Prr29 C A 11: 106,376,259 H83Q probably damaging Het
Raly T A 2: 154,859,744 I108N possibly damaging Het
Ranbp9 A T 13: 43,419,622 S475R probably benign Het
Rogdi C A 16: 5,013,498 probably benign Het
Rorc C T 3: 94,372,907 Q6* probably null Het
Sacs T C 14: 61,212,496 L3997S probably damaging Het
Scn2a A T 2: 65,764,606 Y1933F probably benign Het
Sik3 T C 9: 46,210,743 L898P probably damaging Het
Sipa1l1 A G 12: 82,341,406 I135M probably damaging Het
Slc26a3 C A 12: 31,450,935 Q224K probably damaging Het
Sobp G T 10: 43,021,440 N716K probably benign Het
Spata16 A G 3: 26,927,334 D513G probably damaging Het
Stac T C 9: 111,572,326 R351G possibly damaging Het
Tecta T A 9: 42,394,941 T64S probably benign Het
Tert G A 13: 73,628,410 V427M probably damaging Het
Tex15 G A 8: 33,570,720 M333I probably benign Het
Tmbim4 A T 10: 120,220,759 Q72L probably benign Het
Trav9n-4 T C 14: 53,294,799 S37P probably benign Het
Trpv5 A T 6: 41,675,960 M93K possibly damaging Het
Ulk4 T C 9: 121,258,810 E272G probably benign Het
Ulk4 T C 9: 121,266,517 T79A probably benign Het
Upb1 A G 10: 75,412,768 N41D probably benign Het
Wls A T 3: 159,934,329 Y532F probably damaging Het
Zdhhc5 G A 2: 84,715,011 probably benign Het
Zfp109 T C 7: 24,229,360 D216G probably benign Het
Zfp473 G A 7: 44,732,374 A845V probably damaging Het
Other mutations in Plce1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Plce1 APN 19 38745788 missense probably damaging 0.99
IGL00336:Plce1 APN 19 38651906 missense probably damaging 1.00
IGL00430:Plce1 APN 19 38725017 missense probably damaging 1.00
IGL00466:Plce1 APN 19 38721029 missense probably damaging 0.99
IGL00477:Plce1 APN 19 38525132 missense probably benign 0.39
IGL00839:Plce1 APN 19 38698562 missense probably damaging 1.00
IGL01292:Plce1 APN 19 38651785 splice site probably benign
IGL01665:Plce1 APN 19 38524887 missense probably benign 0.01
IGL01826:Plce1 APN 19 38739238 splice site probably benign
IGL01833:Plce1 APN 19 38720981 missense probably damaging 1.00
IGL02201:Plce1 APN 19 38769446 splice site probably benign
IGL02276:Plce1 APN 19 38524757 missense probably benign 0.05
IGL02477:Plce1 APN 19 38719553 splice site probably benign
IGL02746:Plce1 APN 19 38698472 missense probably damaging 1.00
Angel_food UTSW 19 38727013 splice site probably benign
Heavenly UTSW 19 38777989 missense probably damaging 1.00
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0058:Plce1 UTSW 19 38525184 missense possibly damaging 0.90
R0064:Plce1 UTSW 19 38780784 critical splice donor site probably null
R0116:Plce1 UTSW 19 38721821 missense probably benign
R0138:Plce1 UTSW 19 38524419 missense possibly damaging 0.49
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0240:Plce1 UTSW 19 38728886 missense probably damaging 0.99
R0504:Plce1 UTSW 19 38778021 splice site probably benign
R0506:Plce1 UTSW 19 38760138 missense probably benign 0.04
R0578:Plce1 UTSW 19 38777939 missense probably damaging 1.00
R0645:Plce1 UTSW 19 38777989 missense probably damaging 1.00
R0730:Plce1 UTSW 19 38716691 missense probably damaging 0.98
R0920:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38702013 missense probably damaging 1.00
R1223:Plce1 UTSW 19 38767226 missense probably damaging 1.00
R1484:Plce1 UTSW 19 38705339 nonsense probably null
R1488:Plce1 UTSW 19 38716803 missense possibly damaging 0.92
R1598:Plce1 UTSW 19 38720996 missense probably damaging 1.00
R1624:Plce1 UTSW 19 38724775 missense probably damaging 1.00
R1732:Plce1 UTSW 19 38716838 missense possibly damaging 0.56
R1778:Plce1 UTSW 19 38780790 splice site probably benign
R1797:Plce1 UTSW 19 38758948 critical splice donor site probably null
R1872:Plce1 UTSW 19 38760077 missense probably damaging 1.00
R1876:Plce1 UTSW 19 38780623 missense probably damaging 1.00
R1991:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2080:Plce1 UTSW 19 38727013 splice site probably benign
R2103:Plce1 UTSW 19 38777924 missense probably damaging 1.00
R2376:Plce1 UTSW 19 38777986 missense probably benign 0.02
R2471:Plce1 UTSW 19 38779926 missense probably damaging 1.00
R2511:Plce1 UTSW 19 38760054 missense probably damaging 1.00
R2842:Plce1 UTSW 19 38524283 missense probably damaging 1.00
R3037:Plce1 UTSW 19 38777884 missense probably damaging 0.98
R3104:Plce1 UTSW 19 38620519 missense probably benign 0.00
R3700:Plce1 UTSW 19 38705337 missense probably damaging 1.00
R3750:Plce1 UTSW 19 38777899 missense probably benign
R3753:Plce1 UTSW 19 38651834 missense probably benign 0.09
R4027:Plce1 UTSW 19 38524265 missense probably damaging 1.00
R4057:Plce1 UTSW 19 38760119 missense probably damaging 1.00
R4376:Plce1 UTSW 19 38705447 critical splice donor site probably null
R4433:Plce1 UTSW 19 38767301 missense probably damaging 1.00
R4520:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4521:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4522:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4524:Plce1 UTSW 19 38524319 missense possibly damaging 0.46
R4650:Plce1 UTSW 19 38524644 missense probably benign 0.30
R4673:Plce1 UTSW 19 38749396 missense possibly damaging 0.51
R4701:Plce1 UTSW 19 38725007 missense probably benign 0.33
R4828:Plce1 UTSW 19 38769499 missense probably damaging 1.00
R5103:Plce1 UTSW 19 38767215 missense probably damaging 1.00
R5112:Plce1 UTSW 19 38651833 missense probably benign 0.00
R5236:Plce1 UTSW 19 38770347 missense probably benign 0.11
R5268:Plce1 UTSW 19 38758835 missense possibly damaging 0.71
R5288:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5384:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5386:Plce1 UTSW 19 38760091 missense probably damaging 1.00
R5448:Plce1 UTSW 19 38779917 missense probably damaging 1.00
R5452:Plce1 UTSW 19 38620482 missense probably benign 0.01
R6004:Plce1 UTSW 19 38721871 missense probably damaging 1.00
R6062:Plce1 UTSW 19 38524751 missense probably benign
R6147:Plce1 UTSW 19 38702037 missense probably damaging 1.00
R6247:Plce1 UTSW 19 38745845 missense probably damaging 1.00
R6278:Plce1 UTSW 19 38725051 splice site probably null
R6306:Plce1 UTSW 19 38769465 missense probably damaging 1.00
R6317:Plce1 UTSW 19 38524530 nonsense probably null
R6437:Plce1 UTSW 19 38525132 missense probably benign 0.39
R6522:Plce1 UTSW 19 38748521 splice site probably null
R7034:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7036:Plce1 UTSW 19 38739357 missense probably damaging 1.00
R7037:Plce1 UTSW 19 38702017 missense probably damaging 1.00
R7180:Plce1 UTSW 19 38779785 missense probably damaging 1.00
R7189:Plce1 UTSW 19 38760137 missense probably damaging 0.97
R7227:Plce1 UTSW 19 38726902 missense probably benign 0.00
R7253:Plce1 UTSW 19 38698508 missense probably damaging 1.00
R7278:Plce1 UTSW 19 38779896 missense possibly damaging 0.58
R7287:Plce1 UTSW 19 38701903 missense probably benign 0.02
R7422:Plce1 UTSW 19 38651885 missense probably damaging 1.00
R7557:Plce1 UTSW 19 38765404 missense probably benign 0.30
R7607:Plce1 UTSW 19 38524752 missense probably benign
R7615:Plce1 UTSW 19 38524665 missense probably benign 0.18
R7653:Plce1 UTSW 19 38749319 missense probably benign 0.20
R7685:Plce1 UTSW 19 38748433 missense probably benign 0.00
R7716:Plce1 UTSW 19 38716851 missense probably benign
R7744:Plce1 UTSW 19 38620455 missense possibly damaging 0.93
R7790:Plce1 UTSW 19 38780696 missense probably damaging 0.97
R7921:Plce1 UTSW 19 38620553 missense probably benign 0.03
R8070:Plce1 UTSW 19 38701839 missense probably damaging 0.99
R8087:Plce1 UTSW 19 38736521 missense probably damaging 1.00
R8116:Plce1 UTSW 19 38524818 missense probably benign 0.32
R8178:Plce1 UTSW 19 38772979 missense possibly damaging 0.93
R8321:Plce1 UTSW 19 38651936 missense probably benign 0.00
R8416:Plce1 UTSW 19 38772997 missense possibly damaging 0.77
RF018:Plce1 UTSW 19 38717207 missense probably damaging 0.99
X0022:Plce1 UTSW 19 38726999 missense probably damaging 1.00
X0065:Plce1 UTSW 19 38777914 missense possibly damaging 0.48
Z1176:Plce1 UTSW 19 38701894 missense probably damaging 1.00
Z1176:Plce1 UTSW 19 38724980 nonsense probably null
Z1176:Plce1 UTSW 19 38769460 missense probably damaging 1.00
Z1177:Plce1 UTSW 19 38651842 missense probably null 0.48
Predicted Primers PCR Primer
(F):5'- TTGAGCCCTCTTGCCTGTAG -3'
(R):5'- AACAATGTGAGAACATCGTCAG -3'

Sequencing Primer
(F):5'- CTTGCCTGTAGCTTTTGGC -3'
(R):5'- GCCATTTGCAGTGAGTTCAAAG -3'
Posted On2019-05-13