Incidental Mutation 'R0613:Mgst1'
ID54881
Institutional Source Beutler Lab
Gene Symbol Mgst1
Ensembl Gene ENSMUSG00000008540
Gene Namemicrosomal glutathione S-transferase 1
Synonyms
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.312) question?
Stock #R0613 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location138140316-138156755 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 138156245 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 186 (G186D)
Ref Sequence ENSEMBL: ENSMUSP00000112923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008684] [ENSMUST00000118091] [ENSMUST00000120230] [ENSMUST00000120302] [ENSMUST00000120939] [ENSMUST00000140932] [ENSMUST00000204628]
Predicted Effect possibly damaging
Transcript: ENSMUST00000008684
AA Change: G112D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000008684
Gene: ENSMUSG00000008540
AA Change: G112D

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118091
AA Change: G186D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112923
Gene: ENSMUSG00000008540
AA Change: G186D

DomainStartEndE-ValueType
Pfam:MAPEG 90 224 1.9e-28 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120230
AA Change: G112D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113859
Gene: ENSMUSG00000008540
AA Change: G112D

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120302
AA Change: G112D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113257
Gene: ENSMUSG00000008540
AA Change: G112D

DomainStartEndE-ValueType
Pfam:MAPEG 16 150 9.2e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120939
SMART Domains Protein: ENSMUSP00000112646
Gene: ENSMUSG00000008540

DomainStartEndE-ValueType
PDB:2H8A|A 2 74 1e-45 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000140932
AA Change: G8D

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000145306
Gene: ENSMUSG00000008540
AA Change: G8D

DomainStartEndE-ValueType
Pfam:MAPEG 1 46 2.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204628
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The MAPEG (Membrane Associated Proteins in Eicosanoid and Glutathione metabolism) family consists of six human proteins, two of which are involved in the production of leukotrienes and prostaglandin E, important mediators of inflammation. Other family members, demonstrating glutathione S-transferase and peroxidase activities, are involved in cellular defense against toxic, carcinogenic, and pharmacologically active electrophilic compounds. This gene encodes a protein that catalyzes the conjugation of glutathione to electrophiles and the reduction of lipid hydroperoxides. This protein is localized to the endoplasmic reticulum and outer mitochondrial membrane where it is thought to protect these membranes from oxidative stress. Several transcript variants, some non-protein coding and some protein coding, have been found for this gene. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Mgst1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Mgst1 APN 6 138147768 missense probably damaging 0.99
R0319:Mgst1 UTSW 6 138156157 missense possibly damaging 0.81
R0634:Mgst1 UTSW 6 138156331 missense probably damaging 1.00
R0730:Mgst1 UTSW 6 138147669 missense probably benign 0.03
R0862:Mgst1 UTSW 6 138147751 missense probably damaging 1.00
R4447:Mgst1 UTSW 6 138141664 intron probably benign
R4569:Mgst1 UTSW 6 138156215 missense probably damaging 0.99
R4644:Mgst1 UTSW 6 138156370 missense probably damaging 1.00
R4701:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R4930:Mgst1 UTSW 6 138153509 missense probably benign 0.00
R5688:Mgst1 UTSW 6 138141800 intron probably benign
R6307:Mgst1 UTSW 6 138150829 missense probably benign 0.44
R6468:Mgst1 UTSW 6 138141587 unclassified probably null
R6697:Mgst1 UTSW 6 138147753 missense probably damaging 1.00
R6741:Mgst1 UTSW 6 138150838 missense probably damaging 1.00
R6755:Mgst1 UTSW 6 138147772 missense probably damaging 0.99
R6791:Mgst1 UTSW 6 138141807 intron probably benign
R7295:Mgst1 UTSW 6 138147756 missense probably benign 0.11
R7440:Mgst1 UTSW 6 138150844 missense probably benign
R7532:Mgst1 UTSW 6 138153506 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- AGCAAGTTTCAAGCCACCCTTAGC -3'
(R):5'- GCTCCTTTCACGCATTAAAACCTCAG -3'

Sequencing Primer
(F):5'- tagctaATCTTGACTCAAACCCATTC -3'
(R):5'- CCTCAGAAAGAGTTTGAATCCACTG -3'
Posted On2013-07-11