Incidental Mutation 'R7070:Nutm1'
ID548814
Institutional Source Beutler Lab
Gene Symbol Nutm1
Ensembl Gene ENSMUSG00000041358
Gene NameNUT midline carcinoma, family member 1
SynonymsBC125332, Nut
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7070 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location112247948-112259291 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 112249461 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 703 (H703L)
Ref Sequence ENSEMBL: ENSMUSP00000048263 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028554] [ENSMUST00000043970]
Predicted Effect probably benign
Transcript: ENSMUST00000028554
SMART Domains Protein: ENSMUSP00000028554
Gene: ENSMUSG00000027134

DomainStartEndE-ValueType
transmembrane domain 40 62 N/A INTRINSIC
low complexity region 92 113 N/A INTRINSIC
PlsC 123 234 5.73e-24 SMART
low complexity region 411 422 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000043970
AA Change: H703L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000048263
Gene: ENSMUSG00000041358
AA Change: H703L

DomainStartEndE-ValueType
Pfam:NUT 14 541 1.4e-210 PFAM
low complexity region 840 854 N/A INTRINSIC
Pfam:NUT 900 1123 6.7e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,248 Y156H probably damaging Het
Abca13 T A 11: 9,290,701 F855I probably benign Het
Abca2 T G 2: 25,442,995 F1569V probably benign Het
Adcy8 T A 15: 64,920,555 N184I probably damaging Het
Akap3 T C 6: 126,874,024 V835A probably damaging Het
Atg5 T A 10: 44,286,154 L22H probably damaging Het
Atp13a5 A G 16: 29,334,061 F196L possibly damaging Het
C1qtnf9 A G 14: 60,779,783 H254R probably damaging Het
Capza3 C T 6: 140,041,920 R82C probably damaging Het
Ccdc126 A G 6: 49,339,862 D92G probably damaging Het
Cdh12 T A 15: 21,583,829 M585K probably benign Het
Chrnb3 A T 8: 27,393,961 Y242F probably damaging Het
Cngb3 T C 4: 19,425,593 V467A possibly damaging Het
Cnot8 A G 11: 58,117,452 D248G probably benign Het
Cntn1 C T 15: 92,254,036 T452M probably damaging Het
Cygb C A 11: 116,654,025 probably benign Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dcaf17 C T 2: 71,088,513 T477M probably benign Het
Dpp3 A T 19: 4,918,328 F239I probably benign Het
Dst T A 1: 34,275,302 V6442E probably damaging Het
Enpp2 T A 15: 54,899,289 I188F probably damaging Het
Galnt5 A G 2: 57,998,609 M74V probably benign Het
Grin2a T C 16: 9,579,424 D933G possibly damaging Het
Gtf2i T A 5: 134,282,803 E223D probably damaging Het
H2-M5 C A 17: 36,989,159 G41V possibly damaging Het
Hars2 C T 18: 36,791,112 R501* probably null Het
Heatr4 A G 12: 83,969,858 V545A probably benign Het
Hsd3b3 T A 3: 98,742,471 T179S possibly damaging Het
Ighv5-6 A G 12: 113,625,809 V17A probably damaging Het
Jak3 A G 8: 71,684,611 D772G probably damaging Het
Jakmip2 A T 18: 43,557,328 probably null Het
Kcnj15 C G 16: 95,295,831 T104S probably damaging Het
Kndc1 A G 7: 139,921,828 E927G probably damaging Het
Larp1b G T 3: 40,976,651 G275C probably damaging Het
Lyst C A 13: 13,757,444 H3552Q probably benign Het
Mast2 A T 4: 116,310,855 I960N probably benign Het
Mcee G A 7: 64,400,330 V70I possibly damaging Het
Muc16 G A 9: 18,645,923 Q3025* probably null Het
Nrg1 T A 8: 31,849,437 T45S probably damaging Het
Olfr1023 G A 2: 85,887,690 V297I probably benign Het
Olfr1354 A T 10: 78,917,268 I143L probably benign Het
Pbx1 A C 1: 168,195,768 C273G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pigm T A 1: 172,377,666 I323N probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Ptx4 G A 17: 25,122,997 A149T probably benign Het
Rab6a A G 7: 100,629,857 D68G probably damaging Het
Rcan3 C T 4: 135,416,587 E185K probably damaging Het
Rnf14 A G 18: 38,301,728 N76S possibly damaging Het
Rpf1 A T 3: 146,512,184 F192I probably damaging Het
Rps6ka1 T C 4: 133,861,448 T285A probably benign Het
Rrp8 T C 7: 105,734,876 K94E possibly damaging Het
Rsbn1 A G 3: 103,928,983 K122E probably damaging Het
Senp1 T C 15: 98,082,306 T53A possibly damaging Het
Slc23a1 T G 18: 35,621,781 D519A probably damaging Het
Slfn14 T G 11: 83,276,705 R661S probably benign Het
Snta1 T C 2: 154,381,059 E248G probably benign Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stk11ip C T 1: 75,527,615 H297Y probably benign Het
Synpr T A 14: 13,493,628 F76I probably damaging Het
Thegl G T 5: 77,047,277 probably null Het
Tns2 A G 15: 102,104,533 R27G possibly damaging Het
Trav5-4 C T 14: 53,704,455 S95F possibly damaging Het
Ttyh1 T C 7: 4,133,364 Y330H probably damaging Het
Ugt1a2 T A 1: 88,201,502 probably null Het
Vmn2r69 T C 7: 85,411,480 I299V probably damaging Het
Vmn2r90 T A 17: 17,704,051 D37E probably damaging Het
Other mutations in Nutm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01557:Nutm1 APN 2 112251818 missense probably benign 0.36
IGL02190:Nutm1 APN 2 112249406 nonsense probably null
IGL02546:Nutm1 APN 2 112248324 missense probably benign 0.00
IGL02888:Nutm1 APN 2 112250635 missense probably damaging 1.00
IGL03062:Nutm1 APN 2 112248933 missense probably benign 0.16
R1024:Nutm1 UTSW 2 112249929 missense probably benign 0.35
R1314:Nutm1 UTSW 2 112249809 missense probably benign 0.10
R2061:Nutm1 UTSW 2 112255752 nonsense probably null
R4092:Nutm1 UTSW 2 112249464 missense probably damaging 1.00
R4402:Nutm1 UTSW 2 112249809 missense probably damaging 0.99
R4783:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4784:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R4785:Nutm1 UTSW 2 112248936 missense probably benign 0.00
R5184:Nutm1 UTSW 2 112249000 missense possibly damaging 0.57
R5662:Nutm1 UTSW 2 112249300 missense probably benign 0.01
R5922:Nutm1 UTSW 2 112249314 missense possibly damaging 0.93
R6053:Nutm1 UTSW 2 112249090 missense probably benign 0.01
R6344:Nutm1 UTSW 2 112248902 missense possibly damaging 0.91
R6410:Nutm1 UTSW 2 112248729 missense possibly damaging 0.75
R6515:Nutm1 UTSW 2 112256320 missense probably benign 0.01
R6516:Nutm1 UTSW 2 112251217 missense probably damaging 1.00
R6573:Nutm1 UTSW 2 112251043 critical splice donor site probably null
R6950:Nutm1 UTSW 2 112248559 missense probably benign 0.00
R6975:Nutm1 UTSW 2 112256218 missense probably damaging 1.00
R7033:Nutm1 UTSW 2 112256168 missense probably damaging 1.00
R7072:Nutm1 UTSW 2 112251847 missense probably benign 0.34
R7140:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7143:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7294:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7296:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7297:Nutm1 UTSW 2 112250056 missense probably damaging 0.98
R7613:Nutm1 UTSW 2 112249239 missense probably benign 0.00
R8162:Nutm1 UTSW 2 112248472 missense probably benign 0.02
R8252:Nutm1 UTSW 2 112251829 missense probably damaging 1.00
X0065:Nutm1 UTSW 2 112248627 missense probably damaging 1.00
X0066:Nutm1 UTSW 2 112248357 missense probably damaging 1.00
Z1177:Nutm1 UTSW 2 112255716 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGGAATCACACTGTTCCC -3'
(R):5'- TCTGCAAGGACTTGGGTTAG -3'

Sequencing Primer
(F):5'- CTAGGACCTAGAGAAGCACTGTTTC -3'
(R):5'- CTTGGGTTAGAAAAACAGGCTTTGAC -3'
Posted On2019-05-13