Incidental Mutation 'R7070:Rrp8'
ID548835
Institutional Source Beutler Lab
Gene Symbol Rrp8
Ensembl Gene ENSMUSG00000030888
Gene Nameribosomal RNA processing 8, methyltransferase, homolog (yeast)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R7070 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location105731730-105737385 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105734876 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 94 (K94E)
Ref Sequence ENSEMBL: ENSMUSP00000033179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033179] [ENSMUST00000033182] [ENSMUST00000098148] [ENSMUST00000136687] [ENSMUST00000141116] [ENSMUST00000149695] [ENSMUST00000163389]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033179
AA Change: K94E

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000033179
Gene: ENSMUSG00000030888
AA Change: K94E

DomainStartEndE-ValueType
low complexity region 186 202 N/A INTRINSIC
Pfam:Methyltransf_8 238 457 2.4e-107 PFAM
Pfam:Methyltransf_11 314 391 2e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000033182
SMART Domains Protein: ENSMUSP00000033182
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase 193 445 1.5e-25 PFAM
Pfam:Pkinase_Tyr 193 446 7.2e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000098148
AA Change: K140E

PolyPhen 2 Score 0.876 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000095752
Gene: ENSMUSG00000030888
AA Change: K140E

DomainStartEndE-ValueType
low complexity region 232 248 N/A INTRINSIC
Pfam:Methyltransf_8 284 503 7.5e-107 PFAM
Pfam:Methyltransf_11 348 437 2.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127738
Predicted Effect probably benign
Transcript: ENSMUST00000136687
SMART Domains Protein: ENSMUSP00000123443
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141116
SMART Domains Protein: ENSMUSP00000118105
Gene: ENSMUSG00000043866

DomainStartEndE-ValueType
low complexity region 17 39 N/A INTRINSIC
low complexity region 45 91 N/A INTRINSIC
Pfam:TFIID_30kDa 128 177 6.1e-30 PFAM
low complexity region 181 192 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149695
Predicted Effect probably benign
Transcript: ENSMUST00000163389
SMART Domains Protein: ENSMUSP00000130341
Gene: ENSMUSG00000030890

DomainStartEndE-ValueType
ANK 33 62 4.71e-6 SMART
ANK 66 95 1.04e-7 SMART
ANK 99 128 1.02e-1 SMART
Pfam:Pkinase_Tyr 193 446 4e-39 PFAM
Pfam:Pkinase 195 445 3e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,248 Y156H probably damaging Het
Abca13 T A 11: 9,290,701 F855I probably benign Het
Abca2 T G 2: 25,442,995 F1569V probably benign Het
Adcy8 T A 15: 64,920,555 N184I probably damaging Het
Akap3 T C 6: 126,874,024 V835A probably damaging Het
Atg5 T A 10: 44,286,154 L22H probably damaging Het
Atp13a5 A G 16: 29,334,061 F196L possibly damaging Het
C1qtnf9 A G 14: 60,779,783 H254R probably damaging Het
Capza3 C T 6: 140,041,920 R82C probably damaging Het
Ccdc126 A G 6: 49,339,862 D92G probably damaging Het
Cdh12 T A 15: 21,583,829 M585K probably benign Het
Chrnb3 A T 8: 27,393,961 Y242F probably damaging Het
Cngb3 T C 4: 19,425,593 V467A possibly damaging Het
Cnot8 A G 11: 58,117,452 D248G probably benign Het
Cntn1 C T 15: 92,254,036 T452M probably damaging Het
Cygb C A 11: 116,654,025 probably benign Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dcaf17 C T 2: 71,088,513 T477M probably benign Het
Dpp3 A T 19: 4,918,328 F239I probably benign Het
Dst T A 1: 34,275,302 V6442E probably damaging Het
Enpp2 T A 15: 54,899,289 I188F probably damaging Het
Galnt5 A G 2: 57,998,609 M74V probably benign Het
Grin2a T C 16: 9,579,424 D933G possibly damaging Het
Gtf2i T A 5: 134,282,803 E223D probably damaging Het
H2-M5 C A 17: 36,989,159 G41V possibly damaging Het
Hars2 C T 18: 36,791,112 R501* probably null Het
Heatr4 A G 12: 83,969,858 V545A probably benign Het
Hsd3b3 T A 3: 98,742,471 T179S possibly damaging Het
Ighv5-6 A G 12: 113,625,809 V17A probably damaging Het
Jak3 A G 8: 71,684,611 D772G probably damaging Het
Jakmip2 A T 18: 43,557,328 probably null Het
Kcnj15 C G 16: 95,295,831 T104S probably damaging Het
Kndc1 A G 7: 139,921,828 E927G probably damaging Het
Larp1b G T 3: 40,976,651 G275C probably damaging Het
Lyst C A 13: 13,757,444 H3552Q probably benign Het
Mast2 A T 4: 116,310,855 I960N probably benign Het
Mcee G A 7: 64,400,330 V70I possibly damaging Het
Muc16 G A 9: 18,645,923 Q3025* probably null Het
Nrg1 T A 8: 31,849,437 T45S probably damaging Het
Nutm1 T A 2: 112,249,461 H703L probably benign Het
Olfr1023 G A 2: 85,887,690 V297I probably benign Het
Olfr1354 A T 10: 78,917,268 I143L probably benign Het
Pbx1 A C 1: 168,195,768 C273G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pigm T A 1: 172,377,666 I323N probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Ptx4 G A 17: 25,122,997 A149T probably benign Het
Rab6a A G 7: 100,629,857 D68G probably damaging Het
Rcan3 C T 4: 135,416,587 E185K probably damaging Het
Rnf14 A G 18: 38,301,728 N76S possibly damaging Het
Rpf1 A T 3: 146,512,184 F192I probably damaging Het
Rps6ka1 T C 4: 133,861,448 T285A probably benign Het
Rsbn1 A G 3: 103,928,983 K122E probably damaging Het
Senp1 T C 15: 98,082,306 T53A possibly damaging Het
Slc23a1 T G 18: 35,621,781 D519A probably damaging Het
Slfn14 T G 11: 83,276,705 R661S probably benign Het
Snta1 T C 2: 154,381,059 E248G probably benign Het
Son CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG 16: 91,656,841 probably benign Het
Stk11ip C T 1: 75,527,615 H297Y probably benign Het
Synpr T A 14: 13,493,628 F76I probably damaging Het
Thegl G T 5: 77,047,277 probably null Het
Tns2 A G 15: 102,104,533 R27G possibly damaging Het
Trav5-4 C T 14: 53,704,455 S95F possibly damaging Het
Ttyh1 T C 7: 4,133,364 Y330H probably damaging Het
Ugt1a2 T A 1: 88,201,502 probably null Het
Vmn2r69 T C 7: 85,411,480 I299V probably damaging Het
Vmn2r90 T A 17: 17,704,051 D37E probably damaging Het
Other mutations in Rrp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Rrp8 APN 7 105733016 unclassified probably benign
IGL02792:Rrp8 APN 7 105733811 nonsense probably null
IGL03010:Rrp8 APN 7 105734391 missense probably benign 0.01
IGL03404:Rrp8 APN 7 105734938 missense probably benign 0.41
IGL03046:Rrp8 UTSW 7 105734902 missense probably benign 0.00
R0682:Rrp8 UTSW 7 105734011 missense probably damaging 0.97
R2314:Rrp8 UTSW 7 105734804 missense probably benign 0.37
R4222:Rrp8 UTSW 7 105734022 missense possibly damaging 0.86
R4778:Rrp8 UTSW 7 105737274 intron probably benign
R4940:Rrp8 UTSW 7 105734077 nonsense probably null
R5315:Rrp8 UTSW 7 105734000 missense probably benign 0.00
R5480:Rrp8 UTSW 7 105734129 missense probably damaging 1.00
R5630:Rrp8 UTSW 7 105733401 missense possibly damaging 0.83
R6266:Rrp8 UTSW 7 105736389 missense probably damaging 1.00
R6351:Rrp8 UTSW 7 105734809 missense probably damaging 0.99
R6353:Rrp8 UTSW 7 105734118 nonsense probably null
R7092:Rrp8 UTSW 7 105734109 missense probably damaging 1.00
R7632:Rrp8 UTSW 7 105736520 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TTGGTCAACACTGTCCAGGG -3'
(R):5'- CAGTAGCTGAAGCCCATCTCTC -3'

Sequencing Primer
(F):5'- CAGGGGCTGGGTTAGGTGTAAAG -3'
(R):5'- CTTGTTTGCCTCCAGGGACG -3'
Posted On2019-05-13