Mutagenetix > Incidental Mutations

Incidental Mutation 'R7070:Muc16'

548841

Institutional Source

Beutler Lab

Gene Symbol

Muc16

Ensembl Gene

ENSMUSG00000109564

Gene Name

mucin 16

Synonyms

1110008I14Rik, LOC385009

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.197) question?

Stock #

R7070 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

18495455-18674530 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 18645923 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 3025 (Q3025*)

Ref Sequence

ENSEMBL: ENSMUSP00000147104 (fasta)

Predicted Effect

probably null
Transcript: ENSMUST00000208663
AA Change: Q3025*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous null mice are viable and fertile with no gross histological abnormalities. Homozygous male mice father larger litters when crossed to wild-type females. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930544G11Rik	T	C	6: 65,953,248	Y156H	probably damaging	Het
Abca13	T	A	11: 9,290,701	F855I	probably benign	Het
Abca2	T	G	2: 25,442,995	F1569V	probably benign	Het
Adcy8	T	A	15: 64,920,555	N184I	probably damaging	Het
Akap3	T	C	6: 126,874,024	V835A	probably damaging	Het
Atg5	T	A	10: 44,286,154	L22H	probably damaging	Het
Atp13a5	A	G	16: 29,334,061	F196L	possibly damaging	Het
C1qtnf9	A	G	14: 60,779,783	H254R	probably damaging	Het
Capza3	C	T	6: 140,041,920	R82C	probably damaging	Het
Ccdc126	A	G	6: 49,339,862	D92G	probably damaging	Het
Cdh12	T	A	15: 21,583,829	M585K	probably benign	Het
Chrnb3	A	T	8: 27,393,961	Y242F	probably damaging	Het
Cngb3	T	C	4: 19,425,593	V467A	possibly damaging	Het
Cnot8	A	G	11: 58,117,452	D248G	probably benign	Het
Cntn1	C	T	15: 92,254,036	T452M	probably damaging	Het
Cygb	C	A	11: 116,654,025		probably benign	Het
D930020B18Rik	G	A	10: 121,641,974	V35M	probably damaging	Het
Dcaf17	C	T	2: 71,088,513	T477M	probably benign	Het
Dpp3	A	T	19: 4,918,328	F239I	probably benign	Het
Dst	T	A	1: 34,275,302	V6442E	probably damaging	Het
Enpp2	T	A	15: 54,899,289	I188F	probably damaging	Het
Galnt5	A	G	2: 57,998,609	M74V	probably benign	Het
Grin2a	T	C	16: 9,579,424	D933G	possibly damaging	Het
Gtf2i	T	A	5: 134,282,803	E223D	probably damaging	Het
H2-M5	C	A	17: 36,989,159	G41V	possibly damaging	Het
Hars2	C	T	18: 36,791,112	R501*	probably null	Het
Heatr4	A	G	12: 83,969,858	V545A	probably benign	Het
Hsd3b3	T	A	3: 98,742,471	T179S	possibly damaging	Het
Ighv5-6	A	G	12: 113,625,809	V17A	probably damaging	Het
Jak3	A	G	8: 71,684,611	D772G	probably damaging	Het
Jakmip2	A	T	18: 43,557,328		probably null	Het
Kcnj15	C	G	16: 95,295,831	T104S	probably damaging	Het
Kndc1	A	G	7: 139,921,828	E927G	probably damaging	Het
Larp1b	G	T	3: 40,976,651	G275C	probably damaging	Het
Lyst	C	A	13: 13,757,444	H3552Q	probably benign	Het
Mast2	A	T	4: 116,310,855	I960N	probably benign	Het
Mcee	G	A	7: 64,400,330	V70I	possibly damaging	Het
Nrg1	T	A	8: 31,849,437	T45S	probably damaging	Het
Nutm1	T	A	2: 112,249,461	H703L	probably benign	Het
Olfr1023	G	A	2: 85,887,690	V297I	probably benign	Het
Olfr1354	A	T	10: 78,917,268	I143L	probably benign	Het
Pbx1	A	C	1: 168,195,768	C273G	probably damaging	Het
Peg10	ACATCAGGATCC	ACATCAGGATCCCCATCAGGATCC	6: 4,756,454		probably benign	Het
Phf1	A	G	17: 26,934,333	T42A	possibly damaging	Het
Pigm	T	A	1: 172,377,666	I323N	probably damaging	Het
Plcg2	G	A	8: 117,596,306	R700H	probably benign	Het
Ptx4	G	A	17: 25,122,997	A149T	probably benign	Het
Rab6a	A	G	7: 100,629,857	D68G	probably damaging	Het
Rcan3	C	T	4: 135,416,587	E185K	probably damaging	Het
Rnf14	A	G	18: 38,301,728	N76S	possibly damaging	Het
Rpf1	A	T	3: 146,512,184	F192I	probably damaging	Het
Rps6ka1	T	C	4: 133,861,448	T285A	probably benign	Het
Rrp8	T	C	7: 105,734,876	K94E	possibly damaging	Het
Rsbn1	A	G	3: 103,928,983	K122E	probably damaging	Het
Senp1	T	C	15: 98,082,306	T53A	possibly damaging	Het
Slc23a1	T	G	18: 35,621,781	D519A	probably damaging	Het
Slfn14	T	G	11: 83,276,705	R661S	probably benign	Het
Snta1	T	C	2: 154,381,059	E248G	probably benign	Het
Son	CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG	CATGGACTCCCAGATGTTAGCAACCAGCAGTATGGACTCCCAGATGTTAGCAACCAG	16: 91,656,841		probably benign	Het
Stk11ip	C	T	1: 75,527,615	H297Y	probably benign	Het
Synpr	T	A	14: 13,493,628	F76I	probably damaging	Het
Thegl	G	T	5: 77,047,277		probably null	Het
Tns2	A	G	15: 102,104,533	R27G	possibly damaging	Het
Trav5-4	C	T	14: 53,704,455	S95F	possibly damaging	Het
Ttyh1	T	C	7: 4,133,364	Y330H	probably damaging	Het
Ugt1a2	T	A	1: 88,201,502		probably null	Het
Vmn2r69	T	C	7: 85,411,480	I299V	probably damaging	Het
Vmn2r90	T	A	17: 17,704,051	D37E	probably damaging	Het

Other mutations in Muc16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:Muc16	APN	9	18508507	missense	possibly damaging	0.89
IGL01878:Muc16	APN	9	18495543	missense	possibly damaging	0.90
IGL02394:Muc16	APN	9	18498700	missense	probably damaging	0.99
IGL02553:Muc16	APN	9	18498553	critical splice donor site	probably null
R0400:Muc16	UTSW	9	18510534	missense	possibly damaging	0.74
R1620:Muc16	UTSW	9	18510477	missense	possibly damaging	0.89
R1695:Muc16	UTSW	9	18497433	missense	probably damaging	1.00
R3196:Muc16	UTSW	9	18497830	missense	probably damaging	1.00
R5982:Muc16	UTSW	9	18647146	missense	unknown
R5990:Muc16	UTSW	9	18659243	missense	unknown
R6024:Muc16	UTSW	9	18646671	missense	unknown
R6026:Muc16	UTSW	9	18659858	missense	unknown
R6028:Muc16	UTSW	9	18657176	missense	unknown
R6083:Muc16	UTSW	9	18657212	missense	unknown
R6089:Muc16	UTSW	9	18643252	missense	unknown
R6109:Muc16	UTSW	9	18655359	missense	unknown
R6127:Muc16	UTSW	9	18657878	missense	unknown
R6130:Muc16	UTSW	9	18590698	missense	probably damaging	1.00
R6146:Muc16	UTSW	9	18497797	missense	probably damaging	0.98
R6161:Muc16	UTSW	9	18647818	missense	unknown
R6164:Muc16	UTSW	9	18558379	missense	probably damaging	1.00
R6185:Muc16	UTSW	9	18654473	missense	unknown
R6192:Muc16	UTSW	9	18658689	missense	unknown
R6217:Muc16	UTSW	9	18655446	missense	unknown
R6232:Muc16	UTSW	9	18656998	missense	unknown
R6246:Muc16	UTSW	9	18577067	intron	probably null
R6255:Muc16	UTSW	9	18655599	missense	unknown
R6280:Muc16	UTSW	9	18579317	critical splice donor site	probably null
R6286:Muc16	UTSW	9	18644389	missense	unknown
R6287:Muc16	UTSW	9	18659034	missense	unknown
R6307:Muc16	UTSW	9	18647588	missense	unknown
R6310:Muc16	UTSW	9	18641950	missense	probably benign	0.00
R6316:Muc16	UTSW	9	18641819	missense	probably benign	0.01
R6335:Muc16	UTSW	9	18660708	missense	unknown
R6345:Muc16	UTSW	9	18654926	missense	unknown
R6349:Muc16	UTSW	9	18657329	missense	unknown
R6366:Muc16	UTSW	9	18646044	missense	unknown
R6393:Muc16	UTSW	9	18647399	nonsense	probably null
R6440:Muc16	UTSW	9	18641359	missense	probably benign	0.01
R6458:Muc16	UTSW	9	18641721	missense	probably benign	0.01
R6460:Muc16	UTSW	9	18640516	missense	probably benign	0.01
R6481:Muc16	UTSW	9	18550677	critical splice donor site	probably null
R6539:Muc16	UTSW	9	18637325	missense	probably benign	0.25
R6551:Muc16	UTSW	9	18562562	missense	possibly damaging	0.95
R6596:Muc16	UTSW	9	18566715	missense	probably benign	0.18
R6601:Muc16	UTSW	9	18637570	missense	probably benign	0.10
R6602:Muc16	UTSW	9	18609476	intron	probably null
R6615:Muc16	UTSW	9	18647188	missense	unknown
R6625:Muc16	UTSW	9	18660278	missense	unknown
R6668:Muc16	UTSW	9	18640385	missense	probably benign	0.03
R6697:Muc16	UTSW	9	18641291	missense	probably benign	0.01
R6710:Muc16	UTSW	9	18642070	missense	possibly damaging	0.95
R6727:Muc16	UTSW	9	18566690	critical splice donor site	probably null
R6789:Muc16	UTSW	9	18559986	missense	probably benign	0.40
R6806:Muc16	UTSW	9	18537910	critical splice donor site	probably null
R6874:Muc16	UTSW	9	18658769	nonsense	probably null
R6894:Muc16	UTSW	9	18495576	missense	possibly damaging	0.92
R6913:Muc16	UTSW	9	18642663	missense	unknown
R6919:Muc16	UTSW	9	18660299	missense	unknown
R6939:Muc16	UTSW	9	18638537	missense	probably benign	0.04
R6953:Muc16	UTSW	9	18640529	missense	probably benign	0.01
R6956:Muc16	UTSW	9	18645026	missense	unknown
R6977:Muc16	UTSW	9	18645337	missense	unknown
R6996:Muc16	UTSW	9	18645897	missense	unknown
R7011:Muc16	UTSW	9	18637451	missense	probably benign	0.26
R7011:Muc16	UTSW	9	18637543	missense	probably benign	0.10
R7012:Muc16	UTSW	9	18495618	critical splice acceptor site	probably null
R7014:Muc16	UTSW	9	18658236	missense	unknown
R7021:Muc16	UTSW	9	18554919	missense	unknown
R7021:Muc16	UTSW	9	18550831	splice site	probably null
R7038:Muc16	UTSW	9	18620468	missense	probably damaging	0.99
R7057:Muc16	UTSW	9	18646079	missense	unknown
R7058:Muc16	UTSW	9	18639755	missense	probably benign	0.10
R7066:Muc16	UTSW	9	18658021	missense	unknown
R7067:Muc16	UTSW	9	18658251	missense	unknown
R7074:Muc16	UTSW	9	18655650	missense	unknown
R7085:Muc16	UTSW	9	18644849	missense	unknown
R7088:Muc16	UTSW	9	18592680	missense	probably damaging	0.99
R7107:Muc16	UTSW	9	18637298	missense	probably benign	0.10
R7108:Muc16	UTSW	9	18655233	missense	unknown
R7126:Muc16	UTSW	9	18641216	missense	probably benign	0.01
R7128:Muc16	UTSW	9	18643004	missense	unknown
R7145:Muc16	UTSW	9	18655580	missense	unknown
R7179:Muc16	UTSW	9	18642008	missense	probably benign	0.00
R7194:Muc16	UTSW	9	18674454	missense	unknown
R7211:Muc16	UTSW	9	18498570	missense	probably damaging	1.00
R7213:Muc16	UTSW	9	18641416	missense	probably benign	0.01
R7217:Muc16	UTSW	9	18644076	nonsense	probably null
R7221:Muc16	UTSW	9	18642199	missense	probably benign	0.04
R7265:Muc16	UTSW	9	18656472	missense	unknown
R7326:Muc16	UTSW	9	18585013	missense	probably benign	0.03
R7359:Muc16	UTSW	9	18643020	missense	unknown
R7387:Muc16	UTSW	9	18641720	missense	probably benign	0.01
R7391:Muc16	UTSW	9	18639536	missense	probably benign	0.04
R7398:Muc16	UTSW	9	18637742	missense	possibly damaging	0.46
R7419:Muc16	UTSW	9	18641962	missense	probably benign	0.01
R7431:Muc16	UTSW	9	18607993	missense
R7484:Muc16	UTSW	9	18646768	missense	unknown
R7487:Muc16	UTSW	9	18584799	missense	possibly damaging	0.93
R7497:Muc16	UTSW	9	18645089	missense	unknown
R7515:Muc16	UTSW	9	18639662	missense	probably benign	0.00
R7537:Muc16	UTSW	9	18638135	missense	probably benign	0.06
R7538:Muc16	UTSW	9	18642131	missense	probably benign	0.10
R7538:Muc16	UTSW	9	18655451	missense	unknown
R7543:Muc16	UTSW	9	18644732	missense	unknown
R7566:Muc16	UTSW	9	18638629	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AAACTGTGGTATGTGGTTCAGAAG -3'
(R):5'- GCAAAGAAAGCCAGTCGGTC -3'

Sequencing Primer
(F):5'- GGTGAGATCATCATTTGTTGAACAC -3'
(R):5'- AGTCGGTCATTACAACTCTAGCTG -3'

Posted On

2019-05-13