Incidental Mutation 'R0613:Ccl25'
ID54886
Institutional Source Beutler Lab
Gene Symbol Ccl25
Ensembl Gene ENSMUSG00000023235
Gene Namechemokine (C-C motif) ligand 25
SynonymsCKb15, Scya25, TECK
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R0613 (G1)
Quality Score203
Status Validated
Chromosome8
Chromosomal Location4325210-4360020 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4349850 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 94 (V94A)
Ref Sequence ENSEMBL: ENSMUSP00000120719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024004] [ENSMUST00000069762] [ENSMUST00000098949] [ENSMUST00000110982] [ENSMUST00000127460] [ENSMUST00000136191] [ENSMUST00000155797]
Predicted Effect probably benign
Transcript: ENSMUST00000024004
AA Change: V10A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000024004
Gene: ENSMUSG00000023235
AA Change: V10A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000069762
Predicted Effect probably benign
Transcript: ENSMUST00000098949
Predicted Effect probably benign
Transcript: ENSMUST00000110982
AA Change: V10A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000106610
Gene: ENSMUSG00000023235
AA Change: V10A

DomainStartEndE-ValueType
SCY 27 88 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127460
AA Change: V94A

PolyPhen 2 Score 0.422 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120719
Gene: ENSMUSG00000023235
AA Change: V94A

DomainStartEndE-ValueType
transmembrane domain 87 109 N/A INTRINSIC
SCY 111 172 1.34e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136191
AA Change: V63A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117515
Gene: ENSMUSG00000023235
AA Change: V63A

DomainStartEndE-ValueType
Pfam:IL8 23 66 2.3e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155797
Meta Mutation Damage Score 0.4924 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This antimicrobial gene belongs to the subfamily of small cytokine CC genes. Cytokines are a family of secreted proteins involved in immunoregulatory and inflammatory processes. The CC cytokines are proteins characterized by two adjacent cysteines. The cytokine encoded by this gene displays chemotactic activity for dendritic cells, thymocytes, and activated macrophages but is inactive on peripheral blood lymphocytes and neutrophils. The product of this gene binds to chemokine receptor CCR9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired accumulation of antigen-specific CD8+ T lymphocytes within both lamina propria and epithelium of the small intestine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Ccl25
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02070:Ccl25 APN 8 4348700 intron probably benign
IGL02188:Ccl25 APN 8 4348552 intron probably benign
IGL03338:Ccl25 APN 8 4349898 intron probably benign
R0584:Ccl25 UTSW 8 4354085 splice site probably benign
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1208:Ccl25 UTSW 8 4357631 missense possibly damaging 0.92
R1413:Ccl25 UTSW 8 4353892 makesense probably null
R3844:Ccl25 UTSW 8 4354183 missense possibly damaging 0.86
R4279:Ccl25 UTSW 8 4349829 missense probably damaging 1.00
R4921:Ccl25 UTSW 8 4353913 missense possibly damaging 0.92
R7021:Ccl25 UTSW 8 4349641 intron probably benign
R7033:Ccl25 UTSW 8 4349641 intron probably benign
R7630:Ccl25 UTSW 8 4353955 missense probably damaging 1.00
R8317:Ccl25 UTSW 8 4354138 missense probably benign 0.00
R8550:Ccl25 UTSW 8 4327890 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AGCAAGTCCTTTGCCATCTGCC -3'
(R):5'- TGGGGACACTTCATCTCTACCCATC -3'

Sequencing Primer
(F):5'- GCCATCTGCCTCTCTTTCAG -3'
(R):5'- TCTACCTCCAGTAGTACCAGG -3'
Posted On2013-07-11