Incidental Mutation 'R7070:Atp13a5'
Institutional Source Beutler Lab
Gene Symbol Atp13a5
Ensembl Gene ENSMUSG00000048939
Gene NameATPase type 13A5
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7070 (G1)
Quality Score225.009
Status Not validated
Chromosomal Location29231851-29378732 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29334061 bp
Amino Acid Change Phenylalanine to Leucine at position 196 (F196L)
Ref Sequence ENSEMBL: ENSMUSP00000114703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075806] [ENSMUST00000142681] [ENSMUST00000143373] [ENSMUST00000152040]
Predicted Effect possibly damaging
Transcript: ENSMUST00000075806
AA Change: F210L

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075204
Gene: ENSMUSG00000048939
AA Change: F210L

Pfam:P5-ATPase 17 142 4.1e-31 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 228 475 1.5e-35 PFAM
Pfam:Hydrolase 480 759 2.7e-11 PFAM
Pfam:HAD 483 857 1.1e-28 PFAM
Pfam:Cation_ATPase 564 638 1.3e-6 PFAM
transmembrane domain 901 923 N/A INTRINSIC
transmembrane domain 933 950 N/A INTRINSIC
transmembrane domain 971 993 N/A INTRINSIC
transmembrane domain 1042 1061 N/A INTRINSIC
transmembrane domain 1070 1092 N/A INTRINSIC
transmembrane domain 1107 1129 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000142681
AA Change: F210L

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000118627
Gene: ENSMUSG00000048939
AA Change: F210L

Pfam:P5-ATPase 17 142 7.5e-25 PFAM
Cation_ATPase_N 163 223 8.78e0 SMART
Pfam:E1-E2_ATPase 229 475 1e-36 PFAM
Pfam:Hydrolase 480 860 5.9e-16 PFAM
Pfam:HAD 483 857 4e-27 PFAM
Pfam:Hydrolase_like2 565 638 3.7e-8 PFAM
transmembrane domain 901 923 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000143373
SMART Domains Protein: ENSMUSP00000121208
Gene: ENSMUSG00000048939

Pfam:P5-ATPase 17 142 1e-24 PFAM
Pfam:E1-E2_ATPase 196 430 3.2e-34 PFAM
Pfam:Hydrolase 435 815 9.1e-16 PFAM
Pfam:HAD 438 812 6.2e-27 PFAM
Pfam:Hydrolase_like2 520 593 4.8e-8 PFAM
transmembrane domain 856 878 N/A INTRINSIC
transmembrane domain 888 905 N/A INTRINSIC
transmembrane domain 926 948 N/A INTRINSIC
transmembrane domain 997 1016 N/A INTRINSIC
transmembrane domain 1025 1047 N/A INTRINSIC
transmembrane domain 1062 1084 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152040
AA Change: F196L

PolyPhen 2 Score 0.881 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114703
Gene: ENSMUSG00000048939
AA Change: F196L

Pfam:P5-ATPase 17 143 1.4e-25 PFAM
Cation_ATPase_N 149 209 8.78e0 SMART
low complexity region 213 227 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice show a decreased mean percentage of natural killer cells when compared with controls. Male homozygous mutant mice exhibit impaired sensorimotor gating/attention during prepulse inhibition testing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930544G11Rik T C 6: 65,953,248 Y156H probably damaging Het
Abca13 T A 11: 9,290,701 F855I probably benign Het
Abca2 T G 2: 25,442,995 F1569V probably benign Het
Adcy8 T A 15: 64,920,555 N184I probably damaging Het
Akap3 T C 6: 126,874,024 V835A probably damaging Het
Atg5 T A 10: 44,286,154 L22H probably damaging Het
C1qtnf9 A G 14: 60,779,783 H254R probably damaging Het
Capza3 C T 6: 140,041,920 R82C probably damaging Het
Ccdc126 A G 6: 49,339,862 D92G probably damaging Het
Cdh12 T A 15: 21,583,829 M585K probably benign Het
Chrnb3 A T 8: 27,393,961 Y242F probably damaging Het
Cngb3 T C 4: 19,425,593 V467A possibly damaging Het
Cnot8 A G 11: 58,117,452 D248G probably benign Het
Cntn1 C T 15: 92,254,036 T452M probably damaging Het
Cygb C A 11: 116,654,025 probably benign Het
D930020B18Rik G A 10: 121,641,974 V35M probably damaging Het
Dcaf17 C T 2: 71,088,513 T477M probably benign Het
Dpp3 A T 19: 4,918,328 F239I probably benign Het
Dst T A 1: 34,275,302 V6442E probably damaging Het
Enpp2 T A 15: 54,899,289 I188F probably damaging Het
Galnt5 A G 2: 57,998,609 M74V probably benign Het
Grin2a T C 16: 9,579,424 D933G possibly damaging Het
Gtf2i T A 5: 134,282,803 E223D probably damaging Het
H2-M5 C A 17: 36,989,159 G41V possibly damaging Het
Hars2 C T 18: 36,791,112 R501* probably null Het
Heatr4 A G 12: 83,969,858 V545A probably benign Het
Hsd3b3 T A 3: 98,742,471 T179S possibly damaging Het
Ighv5-6 A G 12: 113,625,809 V17A probably damaging Het
Jak3 A G 8: 71,684,611 D772G probably damaging Het
Jakmip2 A T 18: 43,557,328 probably null Het
Kcnj15 C G 16: 95,295,831 T104S probably damaging Het
Kndc1 A G 7: 139,921,828 E927G probably damaging Het
Larp1b G T 3: 40,976,651 G275C probably damaging Het
Lyst C A 13: 13,757,444 H3552Q probably benign Het
Mast2 A T 4: 116,310,855 I960N probably benign Het
Mcee G A 7: 64,400,330 V70I possibly damaging Het
Muc16 G A 9: 18,645,923 Q3025* probably null Het
Nrg1 T A 8: 31,849,437 T45S probably damaging Het
Nutm1 T A 2: 112,249,461 H703L probably benign Het
Olfr1023 G A 2: 85,887,690 V297I probably benign Het
Olfr1354 A T 10: 78,917,268 I143L probably benign Het
Pbx1 A C 1: 168,195,768 C273G probably damaging Het
Peg10 ACATCAGGATCC ACATCAGGATCCCCATCAGGATCC 6: 4,756,454 probably benign Het
Phf1 A G 17: 26,934,333 T42A possibly damaging Het
Pigm T A 1: 172,377,666 I323N probably damaging Het
Plcg2 G A 8: 117,596,306 R700H probably benign Het
Ptx4 G A 17: 25,122,997 A149T probably benign Het
Rab6a A G 7: 100,629,857 D68G probably damaging Het
Rcan3 C T 4: 135,416,587 E185K probably damaging Het
Rnf14 A G 18: 38,301,728 N76S possibly damaging Het
Rpf1 A T 3: 146,512,184 F192I probably damaging Het
Rps6ka1 T C 4: 133,861,448 T285A probably benign Het
Rrp8 T C 7: 105,734,876 K94E possibly damaging Het
Rsbn1 A G 3: 103,928,983 K122E probably damaging Het
Senp1 T C 15: 98,082,306 T53A possibly damaging Het
Slc23a1 T G 18: 35,621,781 D519A probably damaging Het
Slfn14 T G 11: 83,276,705 R661S probably benign Het
Snta1 T C 2: 154,381,059 E248G probably benign Het
Stk11ip C T 1: 75,527,615 H297Y probably benign Het
Synpr T A 14: 13,493,628 F76I probably damaging Het
Thegl G T 5: 77,047,277 probably null Het
Tns2 A G 15: 102,104,533 R27G possibly damaging Het
Trav5-4 C T 14: 53,704,455 S95F possibly damaging Het
Ttyh1 T C 7: 4,133,364 Y330H probably damaging Het
Ugt1a2 T A 1: 88,201,502 probably null Het
Vmn2r69 T C 7: 85,411,480 I299V probably damaging Het
Vmn2r90 T A 17: 17,704,051 D37E probably damaging Het
Other mutations in Atp13a5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00331:Atp13a5 APN 16 29267014 nonsense probably null
IGL00583:Atp13a5 APN 16 29275453 splice site probably benign
IGL01472:Atp13a5 APN 16 29275423 missense probably damaging 1.00
IGL01473:Atp13a5 APN 16 29316724 missense probably damaging 1.00
IGL02142:Atp13a5 APN 16 29234563 missense probably benign 0.01
IGL02346:Atp13a5 APN 16 29327736 nonsense probably null
IGL02454:Atp13a5 APN 16 29232808 missense probably benign 0.35
IGL02557:Atp13a5 APN 16 29248182 missense probably benign 0.24
IGL02651:Atp13a5 APN 16 29334091 splice site probably benign
IGL02697:Atp13a5 APN 16 29348532 missense probably benign
IGL02704:Atp13a5 APN 16 29251328 nonsense probably null
IGL02993:Atp13a5 APN 16 29293504 nonsense probably null
IGL03329:Atp13a5 APN 16 29334065 nonsense probably null
IGL03346:Atp13a5 APN 16 29314604 missense probably benign 0.15
IGL03493:Atp13a5 APN 16 29297524 missense probably benign
PIT4810001:Atp13a5 UTSW 16 29314564 missense probably damaging 1.00
R0356:Atp13a5 UTSW 16 29348755 splice site probably benign
R0393:Atp13a5 UTSW 16 29266929 splice site probably benign
R0456:Atp13a5 UTSW 16 29232740 missense probably benign 0.03
R0526:Atp13a5 UTSW 16 29348740 missense probably damaging 0.97
R0632:Atp13a5 UTSW 16 29298208 missense probably benign 0.00
R0674:Atp13a5 UTSW 16 29248350 splice site probably benign
R1417:Atp13a5 UTSW 16 29298235 missense probably benign 0.00
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1470:Atp13a5 UTSW 16 29349015 missense probably benign 0.19
R1515:Atp13a5 UTSW 16 29333974 missense probably benign 0.23
R1659:Atp13a5 UTSW 16 29293433 missense probably benign
R1723:Atp13a5 UTSW 16 29232799 missense possibly damaging 0.88
R1779:Atp13a5 UTSW 16 29314660 missense possibly damaging 0.67
R1794:Atp13a5 UTSW 16 29321709 missense probably damaging 1.00
R1958:Atp13a5 UTSW 16 29314601 missense probably damaging 1.00
R2218:Atp13a5 UTSW 16 29321646 missense probably damaging 0.99
R2282:Atp13a5 UTSW 16 29237321 missense probably damaging 1.00
R2356:Atp13a5 UTSW 16 29281069 missense probably damaging 1.00
R2365:Atp13a5 UTSW 16 29251256 missense probably benign 0.00
R2497:Atp13a5 UTSW 16 29339071 nonsense probably null
R2517:Atp13a5 UTSW 16 29297397 missense possibly damaging 0.79
R3552:Atp13a5 UTSW 16 29310766 missense probably damaging 1.00
R3685:Atp13a5 UTSW 16 29316755 missense probably damaging 1.00
R3957:Atp13a5 UTSW 16 29298194 missense probably benign 0.01
R4433:Atp13a5 UTSW 16 29282024 missense probably damaging 0.99
R4503:Atp13a5 UTSW 16 29293528 missense probably benign 0.37
R4579:Atp13a5 UTSW 16 29248338 critical splice acceptor site probably null
R4632:Atp13a5 UTSW 16 29348719 missense probably damaging 1.00
R4718:Atp13a5 UTSW 16 29248170 missense probably damaging 1.00
R4865:Atp13a5 UTSW 16 29248160 missense probably damaging 0.98
R4899:Atp13a5 UTSW 16 29378500 missense probably damaging 1.00
R4909:Atp13a5 UTSW 16 29334028 missense possibly damaging 0.81
R5011:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5013:Atp13a5 UTSW 16 29350748 missense probably damaging 1.00
R5032:Atp13a5 UTSW 16 29263450 missense probably damaging 1.00
R5226:Atp13a5 UTSW 16 29248279 missense probably damaging 1.00
R5485:Atp13a5 UTSW 16 29281942 critical splice donor site probably null
R5598:Atp13a5 UTSW 16 29257077 intron probably benign
R5945:Atp13a5 UTSW 16 29237243 missense probably benign 0.06
R5958:Atp13a5 UTSW 16 29339042 missense probably damaging 1.00
R6194:Atp13a5 UTSW 16 29308239 missense probably damaging 1.00
R6214:Atp13a5 UTSW 16 29251407 missense probably damaging 1.00
R6273:Atp13a5 UTSW 16 29348737 missense probably benign 0.10
R6376:Atp13a5 UTSW 16 29237252 missense probably benign 0.00
R6431:Atp13a5 UTSW 16 29251402 missense possibly damaging 0.93
R6495:Atp13a5 UTSW 16 29321622 critical splice donor site probably null
R6619:Atp13a5 UTSW 16 29349015 missense probably benign 0.05
R6853:Atp13a5 UTSW 16 29321662 missense possibly damaging 0.94
R6932:Atp13a5 UTSW 16 29281951 missense probably damaging 1.00
R7343:Atp13a5 UTSW 16 29321749 missense probably benign 0.01
R7425:Atp13a5 UTSW 16 29297460 nonsense probably null
R7570:Atp13a5 UTSW 16 29266963 missense probably damaging 1.00
R7781:Atp13a5 UTSW 16 29297408 missense probably benign 0.00
R7876:Atp13a5 UTSW 16 29321748 missense possibly damaging 0.93
R8358:Atp13a5 UTSW 16 29348987 missense probably damaging 1.00
R8427:Atp13a5 UTSW 16 29349002 missense possibly damaging 0.65
R8435:Atp13a5 UTSW 16 29280929 critical splice donor site probably null
X0023:Atp13a5 UTSW 16 29310782 missense probably damaging 1.00
Z1088:Atp13a5 UTSW 16 29282062 missense probably benign 0.06
Z1177:Atp13a5 UTSW 16 29280969 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2019-05-13