Incidental Mutation 'R6939:Mpdu1'
ID548877
Institutional Source Beutler Lab
Gene Symbol Mpdu1
Ensembl Gene ENSMUSG00000018761
Gene Namemannose-P-dolichol utilization defect 1
SynonymsSupl15h, SL15, LEC35
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.869) question?
Stock #R6939 (G1)
Quality Score219.009
Status Validated
Chromosome11
Chromosomal Location69656697-69662642 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 69658055 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018905] [ENSMUST00000018909] [ENSMUST00000047373] [ENSMUST00000148242] [ENSMUST00000155200]
Predicted Effect probably benign
Transcript: ENSMUST00000018905
SMART Domains Protein: ENSMUSP00000018905
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 141 157 N/A INTRINSIC
CTNS 167 198 5.56e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000018909
SMART Domains Protein: ENSMUSP00000018909
Gene: ENSMUSG00000018765

DomainStartEndE-ValueType
Pfam:Agenet 72 130 1.3e-10 PFAM
KH 227 294 3.06e-3 SMART
KH 295 366 4.16e-5 SMART
low complexity region 368 380 N/A INTRINSIC
low complexity region 389 406 N/A INTRINSIC
low complexity region 423 442 N/A INTRINSIC
low complexity region 475 503 N/A INTRINSIC
Pfam:FXR_C1 504 579 2.5e-36 PFAM
low complexity region 586 599 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047373
SMART Domains Protein: ENSMUSP00000048524
Gene: ENSMUSG00000041287

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
HMG 46 116 6.83e-29 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125389
SMART Domains Protein: ENSMUSP00000129025
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 21 33 N/A INTRINSIC
CTNS 39 70 1.69e-6 SMART
low complexity region 89 104 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129224
SMART Domains Protein: ENSMUSP00000120001
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 36 48 N/A INTRINSIC
CTNS 54 85 1.69e-6 SMART
low complexity region 138 163 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000148242
AA Change: P102S
SMART Domains Protein: ENSMUSP00000133074
Gene: ENSMUSG00000018761
AA Change: P102S

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
low complexity region 98 109 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000155200
SMART Domains Protein: ENSMUSP00000117715
Gene: ENSMUSG00000018761

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
CTNS 56 87 1.69e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.9%
Validation Efficiency 99% (66/67)
MGI Phenotype FUNCTION: This gene encodes a member of the PQ-loop superfamily. A similar gene in human encodes a protein that is required for monosaccharide-P-dolichol-dependent glycosyltransferase reactions, and disruption of this gene is the cause of congenital disorder of glycosylation (CDG) type 1F, a disease linked to defects in protein N-glycosylation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T A 13: 59,742,058 K231N possibly damaging Het
2810403A07Rik T A 3: 88,686,517 M71K probably damaging Het
A1bg G A 15: 60,920,395 P128L probably damaging Het
Acsm3 T C 7: 119,778,455 V401A probably damaging Het
Arhgef11 C A 3: 87,686,920 N93K probably damaging Het
C1ra G A 6: 124,512,801 probably null Het
Camk2a A G 18: 60,958,154 E236G probably damaging Het
Casc1 A G 6: 145,175,219 F625L possibly damaging Het
Cav2 C A 6: 17,281,411 D17E possibly damaging Het
Ccdc149 T C 5: 52,376,265 S520G probably benign Het
Chd4 C A 6: 125,106,538 H674Q probably damaging Het
Clrn2 A T 5: 45,453,754 probably benign Het
Cntnap1 A C 11: 101,186,511 I1000L probably damaging Het
Cyp2c67 T C 19: 39,643,334 T140A possibly damaging Het
D7Ertd443e T C 7: 134,364,479 probably null Het
Dcdc2c G T 12: 28,541,497 Q131K probably benign Het
Dmpk T A 7: 19,088,224 V369E probably damaging Het
Dnah11 A T 12: 118,106,562 W1503R probably damaging Het
Dok2 T C 14: 70,775,605 V71A probably benign Het
Dqx1 A T 6: 83,059,465 Q150L probably damaging Het
Extl3 A G 14: 65,066,740 I740T possibly damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat2 C T 11: 55,252,474 W4183* probably null Het
Fkrp C T 7: 16,811,826 R37Q probably benign Het
Frem3 A G 8: 80,615,145 K1356E probably benign Het
Fus A T 7: 127,972,569 probably benign Het
Gabarapl2 C A 8: 111,942,569 S53* probably null Het
Gjc1 A C 11: 102,800,907 M90R probably damaging Het
Gm30083 C T 14: 34,003,600 probably null Het
Gm7356 T A 17: 14,001,125 Y214F probably benign Het
Hexdc A T 11: 121,222,338 D533V probably benign Het
Ift172 G A 5: 31,257,586 A1364V probably damaging Het
Ighmbp2 A T 19: 3,276,907 F186Y probably damaging Het
Inpp5e C A 2: 26,407,762 probably null Het
Iqcb1 A G 16: 36,839,912 T146A possibly damaging Het
Kcnmb2 A G 3: 32,198,316 Y222C probably damaging Het
Kdm6b A G 11: 69,406,762 W284R probably damaging Het
Ksr2 T A 5: 117,765,561 *952R probably null Het
Ldlrap1 C A 4: 134,767,974 probably benign Het
Mrgprh A T 17: 12,876,935 T21S probably benign Het
Muc16 T A 9: 18,638,537 T5487S probably benign Het
Mydgf A G 17: 56,183,737 probably null Het
Napa T C 7: 16,115,257 C241R possibly damaging Het
Olfr181 A T 16: 58,926,285 Y95* probably null Het
Olfr479 C A 7: 108,055,105 A41E possibly damaging Het
Olfr964-ps1 T C 9: 39,686,891 T18A possibly damaging Het
Pla2g4f A T 2: 120,307,301 L326Q probably damaging Het
Pramef25 T C 4: 143,948,796 T487A probably benign Het
Psme4 T A 11: 30,837,291 Y1029N probably damaging Het
Ptprj T C 2: 90,459,514 T707A possibly damaging Het
Raet1e T A 10: 22,174,357 M13K possibly damaging Het
Rftn2 T C 1: 55,194,349 probably null Het
Rmi1 A G 13: 58,409,355 I473V probably benign Het
Rps6ka4 A G 19: 6,838,069 F186L probably damaging Het
Ryr1 T A 7: 29,052,326 M3672L possibly damaging Het
Smarca5 A T 8: 80,705,320 C890S possibly damaging Het
Tdrd12 C T 7: 35,485,599 probably null Het
Tecta T C 9: 42,347,997 N1530S probably damaging Het
Tenm4 G A 7: 96,553,496 R106H probably benign Het
Tmem94 A G 11: 115,785,830 S54G possibly damaging Het
Tnk2 T C 16: 32,663,878 V41A probably damaging Het
Trpm1 A G 7: 64,268,297 T462A probably benign Het
Tsg101 T C 7: 46,907,099 T61A probably benign Het
Usp42 T C 5: 143,727,969 N17D probably damaging Het
Zfp607a T A 7: 27,879,048 C514* probably null Het
Zfp866 G T 8: 69,766,221 Q250K probably damaging Het
Other mutations in Mpdu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01075:Mpdu1 APN 11 69657325 missense probably damaging 1.00
IGL02488:Mpdu1 APN 11 69658609 missense probably damaging 1.00
R0010:Mpdu1 UTSW 11 69658841 missense probably damaging 1.00
R6904:Mpdu1 UTSW 11 69658585 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CTGAGTCCCCACCAAAGTTC -3'
(R):5'- AACTTCCCCTTCAGGTGAGTG -3'

Sequencing Primer
(F):5'- GTTCCCATACACAATGCCTGC -3'
(R):5'- GAGGCAAACATCCTTACTTGCTGAG -3'
Posted On2019-05-15