Incidental Mutation 'R6864:Prss12'
ID548884
Institutional Source Beutler Lab
Gene Symbol Prss12
Ensembl Gene ENSMUSG00000027978
Gene Nameprotease, serine 12 neurotrypsin (motopsin)
Synonymsmotopsin, Bssp-3
MMRRC Submission
Accession Numbers

Genbank: NM_008939.2

Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R6864 (G1)
Quality Score63.0073
Status Validated
Chromosome3
Chromosomal Location123446913-123506597 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 123447384 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Asparagine at position 76 (H76N)
Ref Sequence ENSEMBL: ENSMUSP00000029603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029603]
Predicted Effect probably benign
Transcript: ENSMUST00000029603
AA Change: H76N

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000029603
Gene: ENSMUSG00000027978
AA Change: H76N

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 23 43 N/A INTRINSIC
low complexity region 45 64 N/A INTRINSIC
KR 83 159 2.07e-21 SMART
SR 166 266 4.68e-57 SMART
SR 273 372 9.67e-50 SMART
SR 386 486 3.55e-57 SMART
Tryp_SPc 516 755 6.38e-91 SMART
Meta Mutation Damage Score 0.1079 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.2%
  • 20x: 97.2%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. Studies in mouse suggest that the encoded enzyme may be involved in structural reorganizations associated with learning and memory. The enzyme is also expressed in Leydig cells in the testis, but its function in this tissue is unknown. Defects in this gene are a cause of mental retardation autosomal recessive type 1 (MRT1). [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted mutation display hypoactivity and increased anxiety. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgre1 C T 17: 57,478,879 T875I probably damaging Het
Anln A T 9: 22,382,249 S33T probably benign Het
Anxa6 T C 11: 54,986,185 T541A probably benign Het
Atxn2 C T 5: 121,779,494 R334W probably damaging Het
AU040320 T A 4: 126,847,819 V940D probably damaging Het
Bcl2 A T 1: 106,543,281 Y232N probably damaging Het
Bmp7 A G 2: 172,940,062 V3A probably benign Het
Calr A T 8: 84,844,928 H145Q probably damaging Het
Camta2 T A 11: 70,671,966 T976S probably benign Het
Ccnk G A 12: 108,202,214 probably benign Het
Cntln T C 4: 85,096,792 S1107P probably damaging Het
Cradd T C 10: 95,175,927 D117G probably damaging Het
Dcaf7 C T 11: 106,046,821 T90I probably damaging Het
Defb30 T A 14: 63,036,103 probably null Het
Dock4 T A 12: 40,745,746 I854N probably damaging Het
Dym T A 18: 75,056,738 Y132* probably null Het
Eef1a2 T C 2: 181,149,684 T341A probably benign Het
Eml2 T C 7: 19,196,281 V309A probably damaging Het
Fam208a T A 14: 27,461,158 F525I probably damaging Het
Flnb C T 14: 7,905,640 P1130L possibly damaging Het
Hivep3 C A 4: 120,094,888 Q134K possibly damaging Het
Kbtbd2 T A 6: 56,780,026 K242* probably null Het
Kel A G 6: 41,703,760 probably null Het
Lcorl T A 5: 45,747,204 K177N probably damaging Het
Mbd3l2 A G 9: 18,443,499 probably benign Het
Mcm3ap A G 10: 76,507,479 D1735G probably damaging Het
Ms4a1 C A 19: 11,253,178 probably null Het
Muc5ac C T 7: 141,809,744 probably benign Het
Mylk C A 16: 34,874,150 P193Q probably benign Het
Olfr1275 C T 2: 111,231,197 V199I probably benign Het
Olfr1388 G T 11: 49,443,940 A30S probably benign Het
Olfr1390 A T 11: 49,340,753 T74S probably damaging Het
Olfr1424 A T 19: 12,059,413 F113Y probably damaging Het
Olfr339 T A 2: 36,421,820 C141S probably damaging Het
Otogl C T 10: 107,827,806 S968N probably damaging Het
Oxr1 T G 15: 41,823,387 V555G probably damaging Het
Parp12 T C 6: 39,111,736 I189V probably benign Het
Peg3 T C 7: 6,712,762 Y103C probably damaging Het
Plekhh2 T C 17: 84,617,999 V1408A probably benign Het
Prkacb T C 3: 146,745,378 Y204C probably damaging Het
Prkch A G 12: 73,759,617 E546G probably damaging Het
Rai14 G T 15: 10,633,168 S45R possibly damaging Het
Samd9l T A 6: 3,374,750 D837V probably benign Het
Slc22a6 G T 19: 8,618,441 C49F probably damaging Het
Slc2a2 T A 3: 28,721,725 I328N probably damaging Het
Slc35f4 T C 14: 49,318,853 I148V possibly damaging Het
Stk32b A T 5: 37,448,805 probably null Het
Tktl2 T C 8: 66,512,339 I183T probably damaging Het
Tmem175 A C 5: 108,645,979 H325P probably damaging Het
Tns3 A G 11: 8,493,196 V389A probably damaging Het
Trappc9 A T 15: 72,937,162 probably null Het
Trim28 T A 7: 13,029,458 F509I possibly damaging Het
Vmn1r210 T A 13: 22,827,543 Q191L probably benign Het
Vmn2r24 A T 6: 123,779,158 D63V possibly damaging Het
Zfp536 A G 7: 37,568,515 L492P probably damaging Het
Zfp831 C A 2: 174,646,740 N1069K possibly damaging Het
Zfp943 T A 17: 21,992,612 H226Q probably damaging Het
Other mutations in Prss12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Prss12 APN 3 123486949 splice site probably benign
IGL01090:Prss12 APN 3 123482739 missense possibly damaging 0.85
IGL01609:Prss12 APN 3 123482834 missense probably damaging 1.00
IGL02406:Prss12 APN 3 123505474 missense possibly damaging 0.81
IGL02445:Prss12 APN 3 123487020 missense probably damaging 1.00
IGL02928:Prss12 APN 3 123487156 missense possibly damaging 0.51
IGL02970:Prss12 APN 3 123482762 missense probably benign 0.03
IGL03116:Prss12 APN 3 123506276 missense probably benign
IGL03149:Prss12 APN 3 123505387 missense probably benign 0.00
nerd UTSW 3 123447384 missense probably benign 0.31
twerp UTSW 3 123482774 missense probably damaging 1.00
F5426:Prss12 UTSW 3 123506472 missense probably damaging 1.00
P4717OSA:Prss12 UTSW 3 123447618 missense probably damaging 1.00
PIT4576001:Prss12 UTSW 3 123487115 missense probably damaging 1.00
R0116:Prss12 UTSW 3 123482774 missense probably damaging 1.00
R0528:Prss12 UTSW 3 123482796 missense probably benign 0.00
R0762:Prss12 UTSW 3 123485504 missense probably damaging 1.00
R1051:Prss12 UTSW 3 123485525 missense probably null 0.99
R1916:Prss12 UTSW 3 123506495 missense probably benign 0.07
R2185:Prss12 UTSW 3 123487144 missense probably benign 0.01
R2389:Prss12 UTSW 3 123487021 missense possibly damaging 0.63
R2938:Prss12 UTSW 3 123486976 missense probably benign 0.00
R3118:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R3119:Prss12 UTSW 3 123505327 missense possibly damaging 0.92
R4080:Prss12 UTSW 3 123485485 missense probably benign 0.44
R4161:Prss12 UTSW 3 123485527 nonsense probably null
R4997:Prss12 UTSW 3 123447208 missense probably benign 0.01
R5291:Prss12 UTSW 3 123505463 missense probably damaging 0.98
R5597:Prss12 UTSW 3 123464740 missense probably benign 0.18
R5941:Prss12 UTSW 3 123505501 missense probably benign 0.01
R6005:Prss12 UTSW 3 123482768 missense probably benign 0.00
R6119:Prss12 UTSW 3 123489609 missense possibly damaging 0.64
R6430:Prss12 UTSW 3 123479594 missense probably damaging 1.00
R6492:Prss12 UTSW 3 123447399 missense probably benign
R7334:Prss12 UTSW 3 123487131 missense probably benign
R7492:Prss12 UTSW 3 123482776 nonsense probably null
R7669:Prss12 UTSW 3 123447396 missense probably benign
R7898:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
R7981:Prss12 UTSW 3 123506496 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ACTGTCTGTAGTGGCCCGC -3'
(R):5'- CTGGGCATTCCGATAGAAGC -3'

Sequencing Primer
(F):5'- TAGTGGCCCGCGCTGATC -3'
(R):5'- TTCCGATAGAAGCACCAAGGTCTG -3'
Posted On2019-05-15