Incidental Mutation 'R7071:Camk1g'
ID548890
Institutional Source Beutler Lab
Gene Symbol Camk1g
Ensembl Gene ENSMUSG00000016179
Gene Namecalcium/calmodulin-dependent protein kinase I gamma
SynonymsCLICK-III, CaMKIgamma
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location193346346-193370298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 193359809 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 44 (V44E)
Ref Sequence ENSEMBL: ENSMUSP00000016323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016323] [ENSMUST00000169907]
Predicted Effect probably benign
Transcript: ENSMUST00000016323
AA Change: V44E

PolyPhen 2 Score 0.096 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000016323
Gene: ENSMUSG00000016179
AA Change: V44E

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
low complexity region 376 389 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163202
SMART Domains Protein: ENSMUSP00000131451
Gene: ENSMUSG00000016179

DomainStartEndE-ValueType
S_TKc 2 238 5.19e-72 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169907
AA Change: V44E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000128143
Gene: ENSMUSG00000016179
AA Change: V44E

DomainStartEndE-ValueType
S_TKc 23 277 9.53e-112 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein similar to calcium/calmodulin dependent protein kinase, however, its exact function is not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired dendritogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Camk1g
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Camk1g APN 1 193347349 unclassified probably benign
IGL02637:Camk1g APN 1 193348388 missense probably benign 0.38
I2288:Camk1g UTSW 1 193351106 splice site probably benign
R0375:Camk1g UTSW 1 193356401 splice site probably benign
R0433:Camk1g UTSW 1 193354058 missense probably damaging 0.99
R0967:Camk1g UTSW 1 193350296 missense probably damaging 1.00
R1161:Camk1g UTSW 1 193348354 missense probably benign
R1227:Camk1g UTSW 1 193347433 missense possibly damaging 0.73
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1469:Camk1g UTSW 1 193362091 missense possibly damaging 0.89
R1641:Camk1g UTSW 1 193356357 missense probably benign 0.25
R3109:Camk1g UTSW 1 193354993 missense probably damaging 1.00
R3160:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3161:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R3162:Camk1g UTSW 1 193359807 missense possibly damaging 0.66
R4638:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4642:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4644:Camk1g UTSW 1 193356359 missense probably damaging 1.00
R4756:Camk1g UTSW 1 193362085 missense probably benign 0.03
R4781:Camk1g UTSW 1 193356344 missense probably benign 0.00
R4987:Camk1g UTSW 1 193348475 missense probably damaging 0.99
R5224:Camk1g UTSW 1 193355034 missense probably damaging 1.00
R5407:Camk1g UTSW 1 193347372 splice site probably null
R5932:Camk1g UTSW 1 193354039 missense probably benign 0.25
R6725:Camk1g UTSW 1 193350320 missense possibly damaging 0.80
R7808:Camk1g UTSW 1 193350285 missense possibly damaging 0.51
R7908:Camk1g UTSW 1 193359774 missense probably damaging 1.00
R8135:Camk1g UTSW 1 193354027 missense possibly damaging 0.79
Z1176:Camk1g UTSW 1 193362100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAATACCCACAGCTGTG -3'
(R):5'- AGAGCACACTGGTATGTCAGATAG -3'

Sequencing Primer
(F):5'- CTGTGGAAATCAAGCTCATTTGCC -3'
(R):5'- CACTGGTATGTCAGATAGGCAGTG -3'
Posted On2019-05-15