Incidental Mutation 'R7071:Cc2d2a'
ID548901
Institutional Source Beutler Lab
Gene Symbol Cc2d2a
Ensembl Gene ENSMUSG00000039765
Gene Namecoiled-coil and C2 domain containing 2A
Synonymsb2b1035Clo, 5730509K17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_172274; MGI: 1924487

Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location43662346-43740972 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 43709113 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 804 (H804R)
Ref Sequence ENSEMBL: ENSMUSP00000048320 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048150] [ENSMUST00000125866]
Predicted Effect probably benign
Transcript: ENSMUST00000048150
AA Change: H804R

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000048320
Gene: ENSMUSG00000039765
AA Change: H804R

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
low complexity region 124 136 N/A INTRINSIC
low complexity region 203 217 N/A INTRINSIC
coiled coil region 472 501 N/A INTRINSIC
coiled coil region 553 582 N/A INTRINSIC
Pfam:CC2D2AN-C2 645 817 2e-36 PFAM
low complexity region 1005 1017 N/A INTRINSIC
low complexity region 1024 1036 N/A INTRINSIC
C2 1048 1208 3.43e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125866
AA Change: H755R

PolyPhen 2 Score 0.317 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114349
Gene: ENSMUSG00000039765
AA Change: H755R

DomainStartEndE-ValueType
low complexity region 9 18 N/A INTRINSIC
low complexity region 75 87 N/A INTRINSIC
low complexity region 154 168 N/A INTRINSIC
coiled coil region 423 452 N/A INTRINSIC
coiled coil region 504 533 N/A INTRINSIC
Pfam:CC2D2AN-C2 596 768 7.7e-44 PFAM
low complexity region 970 982 N/A INTRINSIC
C2 994 1154 2.3e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil and calcium binding domain protein that appears to play a critical role in cilia formation. Mutations in this gene cause Meckel syndrome type 6, as well as Joubert syndrome type 9. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality with multiorgan defects related to cilia biogenesis. Homozygotes for a gene trap allele show randomized body axis, holoprosencephaly, and microphthalmia. Homozygotes for an ENU-induced allele show heterotaxia, congenital heart anomalies, kidney and eye defects, polydactyly, and cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(4) Gene trapped(1)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Cc2d2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Cc2d2a APN 5 43724380 splice site probably benign
IGL00937:Cc2d2a APN 5 43688122 critical splice acceptor site probably null
IGL01322:Cc2d2a APN 5 43689003 missense probably benign 0.00
IGL01349:Cc2d2a APN 5 43723784 missense probably benign 0.01
IGL01448:Cc2d2a APN 5 43684185 missense possibly damaging 0.65
IGL01871:Cc2d2a APN 5 43688969 missense probably damaging 0.98
IGL01947:Cc2d2a APN 5 43688237 missense probably damaging 0.96
IGL01976:Cc2d2a APN 5 43683115 missense probably benign 0.02
IGL02113:Cc2d2a APN 5 43685248 splice site probably null
IGL02364:Cc2d2a APN 5 43735450 missense probably damaging 1.00
IGL02448:Cc2d2a APN 5 43683205 splice site probably benign
IGL02458:Cc2d2a APN 5 43718554 missense probably benign 0.01
IGL02542:Cc2d2a APN 5 43688910 splice site probably benign
IGL02834:Cc2d2a APN 5 43714521 nonsense probably null
IGL02940:Cc2d2a APN 5 43728294 splice site probably null
IGL03003:Cc2d2a APN 5 43671266 missense probably benign 0.22
IGL03183:Cc2d2a APN 5 43732379 missense probably damaging 1.00
C9142:Cc2d2a UTSW 5 43735457 splice site probably benign
P0028:Cc2d2a UTSW 5 43684199 missense probably benign
R0193:Cc2d2a UTSW 5 43736118 missense probably damaging 1.00
R0201:Cc2d2a UTSW 5 43737512 missense probably damaging 1.00
R0211:Cc2d2a UTSW 5 43688266 splice site probably null
R0243:Cc2d2a UTSW 5 43696638 splice site probably benign
R0317:Cc2d2a UTSW 5 43706901 critical splice donor site probably null
R0453:Cc2d2a UTSW 5 43703294 missense probably benign 0.00
R0558:Cc2d2a UTSW 5 43724387 splice site probably benign
R0624:Cc2d2a UTSW 5 43730029 missense probably benign
R0634:Cc2d2a UTSW 5 43681381 splice site probably benign
R1503:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
R1635:Cc2d2a UTSW 5 43722470 missense probably damaging 1.00
R1686:Cc2d2a UTSW 5 43739371 missense possibly damaging 0.81
R1707:Cc2d2a UTSW 5 43723688 splice site probably null
R1715:Cc2d2a UTSW 5 43718661 missense probably damaging 0.97
R1765:Cc2d2a UTSW 5 43714531 missense probably damaging 0.99
R1794:Cc2d2a UTSW 5 43688252 missense probably damaging 1.00
R1881:Cc2d2a UTSW 5 43740828 missense probably damaging 0.99
R1917:Cc2d2a UTSW 5 43706222 missense probably damaging 1.00
R2005:Cc2d2a UTSW 5 43726373 critical splice donor site probably null
R2201:Cc2d2a UTSW 5 43684033 splice site probably benign
R2244:Cc2d2a UTSW 5 43732433 missense probably damaging 1.00
R2368:Cc2d2a UTSW 5 43703888 missense probably benign
R2442:Cc2d2a UTSW 5 43671305 critical splice donor site probably null
R2511:Cc2d2a UTSW 5 43735395 missense probably damaging 0.99
R3023:Cc2d2a UTSW 5 43685251 splice site probably null
R3147:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3148:Cc2d2a UTSW 5 43709155 missense probably damaging 1.00
R3426:Cc2d2a UTSW 5 43736109 missense probably benign 0.00
R3609:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3610:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3611:Cc2d2a UTSW 5 43712326 missense probably damaging 0.99
R3839:Cc2d2a UTSW 5 43718714 missense probably benign
R3870:Cc2d2a UTSW 5 43718691 nonsense probably null
R4334:Cc2d2a UTSW 5 43683134 missense probably benign 0.00
R4913:Cc2d2a UTSW 5 43739323 missense probably benign 0.12
R5179:Cc2d2a UTSW 5 43688221 missense possibly damaging 0.82
R5315:Cc2d2a UTSW 5 43720433 missense probably damaging 0.99
R5352:Cc2d2a UTSW 5 43706213 missense probably damaging 1.00
R5386:Cc2d2a UTSW 5 43730041 missense probably benign 0.01
R5538:Cc2d2a UTSW 5 43695176 missense possibly damaging 0.94
R5568:Cc2d2a UTSW 5 43709091 missense probably damaging 0.99
R5618:Cc2d2a UTSW 5 43729907 missense probably benign 0.00
R5653:Cc2d2a UTSW 5 43722462 missense possibly damaging 0.81
R5817:Cc2d2a UTSW 5 43712418 missense probably damaging 1.00
R5858:Cc2d2a UTSW 5 43715775 missense probably damaging 1.00
R5905:Cc2d2a UTSW 5 43712426 missense probably benign
R5912:Cc2d2a UTSW 5 43720430 missense probably damaging 0.97
R6073:Cc2d2a UTSW 5 43729975 missense probably damaging 1.00
R6084:Cc2d2a UTSW 5 43668673 missense probably benign
R6142:Cc2d2a UTSW 5 43703198 missense probably damaging 0.97
R6176:Cc2d2a UTSW 5 43709113 missense probably benign 0.32
R6238:Cc2d2a UTSW 5 43671235 missense probably benign 0.11
R6381:Cc2d2a UTSW 5 43715776 missense possibly damaging 0.69
R6404:Cc2d2a UTSW 5 43704074 missense possibly damaging 0.58
R6455:Cc2d2a UTSW 5 43739412 missense possibly damaging 0.69
R6695:Cc2d2a UTSW 5 43718677 missense probably damaging 0.99
R6805:Cc2d2a UTSW 5 43681331 missense probably damaging 1.00
R6919:Cc2d2a UTSW 5 43703215 missense probably benign 0.19
R6970:Cc2d2a UTSW 5 43718585 missense probably damaging 1.00
R7024:Cc2d2a UTSW 5 43733929 missense probably benign 0.10
R7054:Cc2d2a UTSW 5 43699979 nonsense probably null
R7098:Cc2d2a UTSW 5 43683139 missense probably benign 0.00
R7366:Cc2d2a UTSW 5 43729990 missense probably damaging 1.00
R7908:Cc2d2a UTSW 5 43706846 missense probably benign 0.00
R7920:Cc2d2a UTSW 5 43739309 missense probably benign 0.09
R7950:Cc2d2a UTSW 5 43695296 critical splice donor site probably null
R8007:Cc2d2a UTSW 5 43706100 missense possibly damaging 0.71
R8117:Cc2d2a UTSW 5 43712439 missense probably damaging 1.00
R8123:Cc2d2a UTSW 5 43710554 missense probably benign
R8179:Cc2d2a UTSW 5 43699953 missense probably damaging 0.96
R8279:Cc2d2a UTSW 5 43736145 missense probably benign 0.01
R8293:Cc2d2a UTSW 5 43688228 missense probably damaging 0.97
R8482:Cc2d2a UTSW 5 43695239 missense probably damaging 1.00
Z1177:Cc2d2a UTSW 5 43703204 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTGGAGCATGCACTCTCAC -3'
(R):5'- GCCCGTGTCTCTAATATAGTCAC -3'

Sequencing Primer
(F):5'- GAGCATGCACTCTCACCTCCC -3'
(R):5'- CGTGTCTCTAATATAGTCACCAGTTC -3'
Posted On2019-05-15