Incidental Mutation 'R7071:Ceacam5'
ID548904
Institutional Source Beutler Lab
Gene Symbol Ceacam5
Ensembl Gene ENSMUSG00000008789
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 5
SynonymsPsg30, 1600029H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location17713238-17761132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 17750652 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 440 (I440L)
Ref Sequence ENSEMBL: ENSMUSP00000080582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081907]
Predicted Effect possibly damaging
Transcript: ENSMUST00000081907
AA Change: I440L

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000080582
Gene: ENSMUSG00000008789
AA Change: I440L

DomainStartEndE-ValueType
IG 40 141 4.46e-1 SMART
IG_like 160 261 2.96e1 SMART
IG_like 277 378 5.86e0 SMART
IG_like 397 496 4.07e1 SMART
IG 514 615 2.64e0 SMART
IG_like 634 735 2.81e1 SMART
IG 753 853 1.72e-2 SMART
IGc2 869 933 1.28e-10 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Ceacam5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Ceacam5 APN 7 17759556 nonsense probably null
IGL00981:Ceacam5 APN 7 17745533 missense probably benign 0.08
IGL01314:Ceacam5 APN 7 17747256 nonsense probably null
IGL01329:Ceacam5 APN 7 17745609 missense probably damaging 0.98
IGL01389:Ceacam5 APN 7 17747375 missense probably damaging 0.96
IGL01418:Ceacam5 APN 7 17745599 missense probably damaging 1.00
IGL02418:Ceacam5 APN 7 17759434 missense possibly damaging 0.71
IGL02734:Ceacam5 APN 7 17750812 missense probably damaging 1.00
IGL03220:Ceacam5 APN 7 17760728 missense probably damaging 1.00
IGL03377:Ceacam5 APN 7 17715131 missense probably benign 0.15
IGL03395:Ceacam5 APN 7 17745379 splice site probably benign
IGL03054:Ceacam5 UTSW 7 17759454 missense possibly damaging 0.71
R0456:Ceacam5 UTSW 7 17760851 missense possibly damaging 0.63
R0624:Ceacam5 UTSW 7 17714963 missense probably benign 0.03
R0847:Ceacam5 UTSW 7 17757837 missense possibly damaging 0.71
R0879:Ceacam5 UTSW 7 17757702 missense probably benign 0.16
R0945:Ceacam5 UTSW 7 17747344 missense probably damaging 1.00
R1382:Ceacam5 UTSW 7 17752165 missense probably benign 0.33
R1474:Ceacam5 UTSW 7 17747234 missense probably damaging 1.00
R1526:Ceacam5 UTSW 7 17750695 missense probably damaging 1.00
R1793:Ceacam5 UTSW 7 17747395 missense probably benign 0.01
R1851:Ceacam5 UTSW 7 17714910 nonsense probably null
R1907:Ceacam5 UTSW 7 17752384 missense possibly damaging 0.85
R1913:Ceacam5 UTSW 7 17759577 nonsense probably null
R1990:Ceacam5 UTSW 7 17757880 missense probably damaging 0.99
R1999:Ceacam5 UTSW 7 17747247 missense possibly damaging 0.66
R2336:Ceacam5 UTSW 7 17747375 missense probably benign 0.28
R2355:Ceacam5 UTSW 7 17745635 missense probably damaging 1.00
R3106:Ceacam5 UTSW 7 17747323 missense probably benign 0.06
R3423:Ceacam5 UTSW 7 17757637 missense possibly damaging 0.52
R3432:Ceacam5 UTSW 7 17714976 missense probably benign 0.06
R3686:Ceacam5 UTSW 7 17760823 missense possibly damaging 0.94
R3713:Ceacam5 UTSW 7 17759338 missense possibly damaging 0.52
R3878:Ceacam5 UTSW 7 17750581 missense probably damaging 1.00
R4214:Ceacam5 UTSW 7 17752151 missense probably benign 0.00
R4335:Ceacam5 UTSW 7 17752129 missense probably benign
R4725:Ceacam5 UTSW 7 17760677 missense probably benign 0.26
R4823:Ceacam5 UTSW 7 17757744 missense possibly damaging 0.71
R4833:Ceacam5 UTSW 7 17752258 missense probably benign
R4986:Ceacam5 UTSW 7 17757833 missense possibly damaging 0.85
R5099:Ceacam5 UTSW 7 17745588 missense probably damaging 0.96
R5365:Ceacam5 UTSW 7 17759548 missense probably damaging 0.98
R5522:Ceacam5 UTSW 7 17715080 missense probably benign
R5605:Ceacam5 UTSW 7 17747236 missense probably benign 0.03
R6199:Ceacam5 UTSW 7 17714885 missense probably benign 0.00
R6222:Ceacam5 UTSW 7 17745547 missense probably benign 0.15
R6320:Ceacam5 UTSW 7 17747198 missense probably damaging 1.00
R6464:Ceacam5 UTSW 7 17747466 critical splice donor site probably null
R6521:Ceacam5 UTSW 7 17750831 critical splice donor site probably null
R6568:Ceacam5 UTSW 7 17745491 missense probably damaging 1.00
R6573:Ceacam5 UTSW 7 17713447 start codon destroyed probably null 0.70
R6814:Ceacam5 UTSW 7 17752287 nonsense probably null
R6872:Ceacam5 UTSW 7 17752287 nonsense probably null
R6930:Ceacam5 UTSW 7 17750834 splice site probably null
R7121:Ceacam5 UTSW 7 17745537 missense probably benign 0.29
R7174:Ceacam5 UTSW 7 17757914 critical splice donor site probably null
R7187:Ceacam5 UTSW 7 17759485 missense possibly damaging 0.85
R7355:Ceacam5 UTSW 7 17747387 missense probably damaging 1.00
R7411:Ceacam5 UTSW 7 17750753 missense probably damaging 0.99
R7462:Ceacam5 UTSW 7 17760839 missense probably damaging 1.00
R7612:Ceacam5 UTSW 7 17759416 missense possibly damaging 0.86
R7803:Ceacam5 UTSW 7 17759392 missense probably damaging 0.98
R7943:Ceacam5 UTSW 7 17745566 missense probably benign 0.26
R8342:Ceacam5 UTSW 7 17752246 missense possibly damaging 0.53
R8356:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8426:Ceacam5 UTSW 7 17759341 missense possibly damaging 0.51
R8456:Ceacam5 UTSW 7 17745699 missense possibly damaging 0.68
R8534:Ceacam5 UTSW 7 17750746 missense probably benign 0.20
R8815:Ceacam5 UTSW 7 17759360 missense possibly damaging 0.85
R8871:Ceacam5 UTSW 7 17760902 missense probably benign 0.12
X0020:Ceacam5 UTSW 7 17760909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTTGTTTCAAACTCCAAGG -3'
(R):5'- GTATAAGCCTCACCCATCAGTG -3'

Sequencing Primer
(F):5'- GTTTCAAACTCCAAGGACTCTG -3'
(R):5'- ACTTACTGTCCAGCTGGAGTTGAAC -3'
Posted On2019-05-15