Incidental Mutation 'R7071:Ifitm3'
ID548906
Institutional Source Beutler Lab
Gene Symbol Ifitm3
Ensembl Gene ENSMUSG00000025492
Gene Nameinterferon induced transmembrane protein 3
Synonymsmil-1, Fgls, 1110004C05Rik, fragilis, IP15
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location141009586-141010770 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 141010524 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 41 (V41A)
Ref Sequence ENSEMBL: ENSMUSP00000026565 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026565]
Predicted Effect probably benign
Transcript: ENSMUST00000026565
AA Change: V41A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000026565
Gene: ENSMUSG00000025492
AA Change: V41A

DomainStartEndE-ValueType
Pfam:CD225 47 130 7.6e-33 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an interferon-induced membrane protein that helps confer immunity to influenza A H1N1 virus, West Nile virus, and dengue virus. Two transcript variants, only one of them protein-coding, have been found for this gene. Another variant encoding an N-terminally truncated isoform has been reported, but the full-length nature of this variant has not been determined. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a reporter allele are viable and fertile with no detectable defects in embryogenesis or germ cell development but show increased susceptibility to respiratory syncytial virus and influenza A virus infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Ifitm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02039:Ifitm3 APN 7 141010650 utr 5 prime probably benign
IGL02478:Ifitm3 APN 7 141009874 missense possibly damaging 0.68
IGL02889:Ifitm3 APN 7 141009879 missense probably damaging 1.00
I0000:Ifitm3 UTSW 7 141010528 missense possibly damaging 0.85
R1069:Ifitm3 UTSW 7 141009900 splice site probably benign
R4019:Ifitm3 UTSW 7 141009859 missense possibly damaging 0.71
R4991:Ifitm3 UTSW 7 141010459 missense probably damaging 1.00
R5288:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R5385:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R5386:Ifitm3 UTSW 7 141010641 missense probably benign 0.00
R5543:Ifitm3 UTSW 7 141009817 missense unknown
R7602:Ifitm3 UTSW 7 141010459 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGATGGAGCTTCAGGTTCACAC -3'
(R):5'- TCTGAGAAACCGAAACTGCCG -3'

Sequencing Primer
(F):5'- AGGTTCACACACACCTTTTTACAC -3'
(R):5'- ACTGCCGCAGAAAGGGC -3'
Posted On2019-05-15