Incidental Mutation 'R7071:Dot1l'
ID548913
Institutional Source Beutler Lab
Gene Symbol Dot1l
Ensembl Gene ENSMUSG00000061589
Gene NameDOT1-like, histone H3 methyltransferase (S. cerevisiae)
SynonymsmDot1, KMT4
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location80755206-80795461 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80792245 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 1039 (L1039Q)
Ref Sequence ENSEMBL: ENSMUSP00000116581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036805] [ENSMUST00000105336] [ENSMUST00000127740] [ENSMUST00000149394] [ENSMUST00000150338] [ENSMUST00000219378] [ENSMUST00000219959]
Predicted Effect probably benign
Transcript: ENSMUST00000036805
SMART Domains Protein: ENSMUSP00000042334
Gene: ENSMUSG00000035278

DomainStartEndE-ValueType
PH 16 110 1.48e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105336
SMART Domains Protein: ENSMUSP00000100973
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
Pfam:DOT1 115 317 9.4e-86 PFAM
low complexity region 335 348 N/A INTRINSIC
AT_hook 407 419 4.64e-1 SMART
low complexity region 437 447 N/A INTRINSIC
coiled coil region 558 647 N/A INTRINSIC
low complexity region 917 936 N/A INTRINSIC
low complexity region 948 961 N/A INTRINSIC
low complexity region 1084 1095 N/A INTRINSIC
low complexity region 1145 1157 N/A INTRINSIC
low complexity region 1186 1198 N/A INTRINSIC
low complexity region 1436 1446 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127740
Predicted Effect
SMART Domains Protein: ENSMUSP00000119492
Gene: ENSMUSG00000061589
AA Change: L70Q

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 52 64 N/A INTRINSIC
low complexity region 73 87 N/A INTRINSIC
low complexity region 92 137 N/A INTRINSIC
low complexity region 189 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149394
SMART Domains Protein: ENSMUSP00000127762
Gene: ENSMUSG00000061589

DomainStartEndE-ValueType
low complexity region 24 36 N/A INTRINSIC
low complexity region 65 77 N/A INTRINSIC
low complexity region 315 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150338
AA Change: L1039Q

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000116581
Gene: ENSMUSG00000061589
AA Change: L1039Q

DomainStartEndE-ValueType
Pfam:DOT1 1 100 3.4e-37 PFAM
low complexity region 118 131 N/A INTRINSIC
AT_hook 190 202 4.64e-1 SMART
low complexity region 220 230 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
SCOP:d1fxkc_ 396 441 1e-3 SMART
low complexity region 700 719 N/A INTRINSIC
low complexity region 731 744 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
low complexity region 928 940 N/A INTRINSIC
low complexity region 969 981 N/A INTRINSIC
low complexity region 1020 1032 N/A INTRINSIC
low complexity region 1041 1055 N/A INTRINSIC
low complexity region 1060 1105 N/A INTRINSIC
low complexity region 1157 1174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219378
Predicted Effect probably benign
Transcript: ENSMUST00000219959
Meta Mutation Damage Score 0.0708 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a histone methyltransferase that methylates lysine-79 of histone H3. It is inactive against free core histones, but shows significant histone methyltransferase activity against nucleosomes. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a gene trap allele show late embryonic lethality. Mice homozygous for a null allele die by E10.5 displaying a growth arrest, abnormal yolk sac angiogenesis and heart dilation while mutant ES cells show elevated apoptosis, G2 cell cycle arrest, telomere elongation and aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Dot1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01836:Dot1l APN 10 80785866 missense probably benign 0.00
IGL01915:Dot1l APN 10 80780894 missense probably damaging 0.99
IGL02287:Dot1l APN 10 80764609 missense possibly damaging 0.66
IGL02695:Dot1l APN 10 80777608 missense probably damaging 1.00
IGL03058:Dot1l APN 10 80790997 missense probably benign 0.00
IGL03071:Dot1l APN 10 80788679 missense probably benign 0.00
IGL03120:Dot1l APN 10 80786273 splice site probably benign
R0220:Dot1l UTSW 10 80785858 missense probably damaging 0.99
R1342:Dot1l UTSW 10 80786025 missense probably benign 0.14
R1701:Dot1l UTSW 10 80790742 missense possibly damaging 0.93
R1862:Dot1l UTSW 10 80783539 missense probably damaging 1.00
R2094:Dot1l UTSW 10 80785878 missense probably damaging 1.00
R2308:Dot1l UTSW 10 80789069 missense probably damaging 1.00
R4274:Dot1l UTSW 10 80783988 critical splice donor site probably null
R4617:Dot1l UTSW 10 80785084 missense probably damaging 0.97
R4623:Dot1l UTSW 10 80782150 missense probably benign 0.18
R4690:Dot1l UTSW 10 80786182 nonsense probably null
R5009:Dot1l UTSW 10 80771196 missense probably benign 0.25
R5072:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5073:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5074:Dot1l UTSW 10 80784646 missense possibly damaging 0.83
R5305:Dot1l UTSW 10 80790793 missense probably benign 0.03
R5312:Dot1l UTSW 10 80784637 missense possibly damaging 0.94
R5512:Dot1l UTSW 10 80788991 missense possibly damaging 0.92
R5551:Dot1l UTSW 10 80783628 small deletion probably benign
R5552:Dot1l UTSW 10 80783628 small deletion probably benign
R5553:Dot1l UTSW 10 80783628 small deletion probably benign
R6056:Dot1l UTSW 10 80786095 missense probably damaging 0.96
R6207:Dot1l UTSW 10 80786443 missense probably benign 0.06
R6419:Dot1l UTSW 10 80791481 missense possibly damaging 0.85
R6782:Dot1l UTSW 10 80789390 missense probably damaging 1.00
R7054:Dot1l UTSW 10 80787023 missense probably damaging 0.99
R7097:Dot1l UTSW 10 80790726 missense probably damaging 0.98
R7131:Dot1l UTSW 10 80792341 missense unknown
R7459:Dot1l UTSW 10 80773173 missense probably damaging 0.96
R7687:Dot1l UTSW 10 80789368 missense possibly damaging 0.70
R7741:Dot1l UTSW 10 80783544 missense probably damaging 1.00
X0066:Dot1l UTSW 10 80788683 missense possibly damaging 0.94
X0066:Dot1l UTSW 10 80788684 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTGGTGAGAAATGAGTCCAG -3'
(R):5'- ACTGGCTCAGGGTTAGAAGC -3'

Sequencing Primer
(F):5'- TGGCAGGTAAGTGTCCCAC -3'
(R):5'- GGGTTAGAAGCCAGCAGC -3'
Posted On2019-05-15