Mutagenetix > Incidental Mutations

Incidental Mutation 'R7071:Cobl'

548914

Institutional Source

Beutler Lab

Gene Symbol

Cobl

Ensembl Gene

ENSMUSG00000020173

Gene Name

cordon-bleu WH2 repeat

Synonyms

C530045F18Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7071 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

12236608-12464960 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 12254795 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 636 (C636R)

Ref Sequence

ENSEMBL: ENSMUSP00000045693 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000046755] [ENSMUST00000109650] [ENSMUST00000109651] [ENSMUST00000172919] [ENSMUST00000172956] [ENSMUST00000174874]

PDB Structure

Actin complex with Gelsolin Segment 1 fused to Cobl segment [X-RAY DIFFRACTION]
Crystal Structure of an Actin Dimer in Complex with the Actin Nucleator Cordon-Bleu [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000046755
AA Change: C636R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000045693
Gene: ENSMUSG00000020173
AA Change: C636R

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	144	235	2.2e-46	PFAM
low complexity region	328	333	N/A	INTRINSIC
low complexity region	360	376	N/A	INTRINSIC
low complexity region	408	433	N/A	INTRINSIC
low complexity region	468	482	N/A	INTRINSIC
low complexity region	526	541	N/A	INTRINSIC
coiled coil region	564	589	N/A	INTRINSIC
WH2	1185	1205	1.32e0	SMART
WH2	1225	1245	6.36e-3	SMART
low complexity region	1276	1296	N/A	INTRINSIC
WH2	1313	1333	3.91e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109650
AA Change: C554R

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000105277
Gene: ENSMUSG00000020173
AA Change: C554R

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.6e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	386	400	N/A	INTRINSIC
low complexity region	444	459	N/A	INTRINSIC
coiled coil region	482	507	N/A	INTRINSIC
WH2	1103	1123	1.32e0	SMART
WH2	1143	1163	6.36e-3	SMART
low complexity region	1194	1214	N/A	INTRINSIC
WH2	1231	1251	3.91e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000109651
AA Change: C611R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000105278
Gene: ENSMUSG00000020173
AA Change: C611R

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	1.2e-40	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC
low complexity region	383	408	N/A	INTRINSIC
low complexity region	443	457	N/A	INTRINSIC
low complexity region	501	516	N/A	INTRINSIC
coiled coil region	539	564	N/A	INTRINSIC
WH2	1160	1180	1.32e0	SMART
WH2	1200	1220	6.36e-3	SMART
low complexity region	1251	1271	N/A	INTRINSIC
WH2	1288	1308	3.91e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000172919

SMART Domains

Protein: ENSMUSP00000133669
Gene: ENSMUSG00000020173

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.6e-41	PFAM
low complexity region	328	333	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000172956

SMART Domains

Protein: ENSMUSP00000134372
Gene: ENSMUSG00000020173

Domain	Start	End	E-Value	Type
low complexity region	14	30	N/A	INTRINSIC
Pfam:Cobl	182	260	2.4e-41	PFAM
low complexity region	303	308	N/A	INTRINSIC
low complexity region	335	351	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174874
AA Change: C629R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000133470
Gene: ENSMUSG00000020173
AA Change: C629R

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
Pfam:Cobl	175	253	1.2e-40	PFAM
low complexity region	321	326	N/A	INTRINSIC
low complexity region	353	369	N/A	INTRINSIC
low complexity region	401	426	N/A	INTRINSIC
low complexity region	461	475	N/A	INTRINSIC
low complexity region	519	534	N/A	INTRINSIC
coiled coil region	557	582	N/A	INTRINSIC
WH2	1178	1198	1.32e0	SMART
WH2	1218	1238	6.36e-3	SMART
low complexity region	1269	1289	N/A	INTRINSIC
WH2	1306	1326	3.91e-3	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.1%

Validation Efficiency

95% (41/43)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains WH2 domains (WASP, Wiskott-Aldrich syndrome protein, homology domain-2) that interact with actin. The encoded actin regulator protein is required for growth and assembly of brush border microvilli that play a role in maintaining intestinal homeostasis. A similar protein in mouse functions in midbrain neural tube closure. A pseudogene of this gene is located on chromosome X. [provided by RefSeq, Oct 2016]
PHENOTYPE: Animals homozygous for this mutation do not display a phenotype. However, the allele exacerbates the neural tube defects seen in the loop tail mouse. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 41 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi3bp	C	T	16: 56,629,140	Q854*	probably null	Het
Arl2bp	G	T	8: 94,667,166		probably benign	Het
Astl	T	C	2: 127,345,965	M121T	probably benign	Het
Atrip	T	C	9: 109,067,014		probably null	Het
Camk1g	A	T	1: 193,359,809	V44E	probably benign	Het
Cc2d2a	A	G	5: 43,709,113	H804R	probably benign	Het
Cd300a	T	C	11: 114,901,273	S314P	probably damaging	Het
Ceacam5	A	T	7: 17,750,652	I440L	possibly damaging	Het
Cfap61	T	G	2: 146,001,912	I306R	probably benign	Het
Cnot10	T	C	9: 114,617,719		probably null	Het
Cntln	T	A	4: 85,100,385	L76Q	probably damaging	Het
Dnm3	A	T	1: 162,019,843	H148Q	probably damaging	Het
Dot1l	T	A	10: 80,792,245	L1039Q	probably benign	Het
Faiml	T	A	9: 99,236,347	M1L	unknown	Het
Fat1	T	G	8: 44,989,108	I1149S	possibly damaging	Het
Gatad1	T	C	5: 3,643,540	R210G	probably benign	Het
Gm11938	A	T	11: 99,603,084	C62S	probably damaging	Het
Gm15448	A	G	7: 3,821,668	S573P	unknown	Het
Gtf2i	A	G	5: 134,263,621	L423S	probably damaging	Het
Hmcn1	A	T	1: 150,604,102	C4582S	probably damaging	Het
Ifitm3	A	G	7: 141,010,524	V41A	probably benign	Het
Ipo11	T	A	13: 106,925,096	S19C	probably damaging	Het
Khsrp	C	A	17: 57,025,386	M268I	possibly damaging	Het
Lrp1b	T	G	2: 41,408,264	D1036A		Het
Mecom	T	G	3: 29,980,708	H273P	probably damaging	Het
Mfn1	G	A	3: 32,568,395	V601I	probably benign	Het
Mrps5	T	A	2: 127,600,852	Y280*	probably null	Het
Myo18a	A	G	11: 77,823,827	T811A	probably damaging	Het
Ndfip2	A	C	14: 105,302,326	N292H	possibly damaging	Het
Olfr318	C	A	11: 58,720,158	V297F	possibly damaging	Het
Otog	T	A	7: 46,267,323	C895S	probably damaging	Het
Pacs1	A	T	19: 5,156,374	I261N	possibly damaging	Het
Ptprn	A	T	1: 75,260,619	M113K	possibly damaging	Het
Rag1	T	C	2: 101,643,462	H445R	probably damaging	Het
Ranbp2	T	G	10: 58,492,837	F2853V	probably damaging	Het
Skint5	A	T	4: 113,779,080	F647Y	unknown	Het
Stt3b	T	C	9: 115,254,017	Y449C	probably damaging	Het
Ythdc2	A	G	18: 44,845,788	D455G	probably benign	Het
Zfp451	A	C	1: 33,776,744	D708E	possibly damaging	Het
Zfp456	T	C	13: 67,372,777	E33G	probably damaging	Het
Zfp599	T	C	9: 22,258,096	T27A	probably benign	Het

Other mutations in Cobl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00338:Cobl	APN	11	12375813	missense	possibly damaging	0.89
IGL00698:Cobl	APN	11	12253722	missense	probably benign	0.41
IGL00772:Cobl	APN	11	12266985	missense	probably benign	0.02
IGL00922:Cobl	APN	11	12254866	missense	probably damaging	1.00
IGL00985:Cobl	APN	11	12254843	missense	probably damaging	1.00
IGL01641:Cobl	APN	11	12309641	nonsense	probably null
IGL01722:Cobl	APN	11	12253987	missense	probably benign	0.00
IGL01734:Cobl	APN	11	12254980	splice site	probably benign
IGL01924:Cobl	APN	11	12254596	missense	probably benign	0.30
IGL02105:Cobl	APN	11	12249651	missense	probably damaging	1.00
IGL02326:Cobl	APN	11	12386712	missense	possibly damaging	0.69
IGL02342:Cobl	APN	11	12253672	missense	possibly damaging	0.64
IGL02426:Cobl	APN	11	12254351	nonsense	probably null
IGL02754:Cobl	APN	11	12254371	missense	probably damaging	1.00
IGL02754:Cobl	APN	11	12254370	missense	probably damaging	1.00
IGL02811:Cobl	APN	11	12253285	missense	possibly damaging	0.56
IGL02859:Cobl	APN	11	12369602	missense	probably damaging	1.00
IGL02999:Cobl	APN	11	12343869	missense	possibly damaging	0.71
IGL03030:Cobl	APN	11	12254241	missense	possibly damaging	0.80
IGL03191:Cobl	APN	11	12253364	missense	probably benign	0.00
PIT4418001:Cobl	UTSW	11	12256240	missense	possibly damaging	0.79
PIT4480001:Cobl	UTSW	11	12253592	missense	probably benign
PIT4495001:Cobl	UTSW	11	12254596	missense	probably benign	0.00
R0031:Cobl	UTSW	11	12254945	missense	probably benign	0.36
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0241:Cobl	UTSW	11	12254524	missense	probably benign	0.25
R0322:Cobl	UTSW	11	12267072	missense	probably damaging	1.00
R0597:Cobl	UTSW	11	12254699	missense	probably benign	0.24
R0733:Cobl	UTSW	11	12365167	missense	probably benign	0.31
R0734:Cobl	UTSW	11	12375971	missense	probably damaging	1.00
R0784:Cobl	UTSW	11	12266843	splice site	probably benign
R0884:Cobl	UTSW	11	12375908	missense	possibly damaging	0.89
R1065:Cobl	UTSW	11	12254327	missense	possibly damaging	0.67
R1331:Cobl	UTSW	11	12375853	missense	probably damaging	0.96
R1892:Cobl	UTSW	11	12253258	missense	probably damaging	0.99
R2847:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R2848:Cobl	UTSW	11	12378342	missense	probably damaging	1.00
R3407:Cobl	UTSW	11	12375830	missense	probably damaging	1.00
R4627:Cobl	UTSW	11	12251093	missense	probably damaging	1.00
R4662:Cobl	UTSW	11	12253672	missense	probably benign	0.08
R4677:Cobl	UTSW	11	12386665	missense	possibly damaging	0.93
R4844:Cobl	UTSW	11	12254740	missense	probably benign	0.10
R4942:Cobl	UTSW	11	12254185	missense	probably damaging	0.99
R5158:Cobl	UTSW	11	12256198	missense	possibly damaging	0.84
R5195:Cobl	UTSW	11	12253565	missense	probably benign	0.02
R5255:Cobl	UTSW	11	12375825	missense	probably damaging	1.00
R5588:Cobl	UTSW	11	12343886	nonsense	probably null
R5637:Cobl	UTSW	11	12296531	intron	probably benign
R5643:Cobl	UTSW	11	12306948	splice site	probably benign
R5749:Cobl	UTSW	11	12266965	missense	possibly damaging	0.86
R5953:Cobl	UTSW	11	12256220	missense	probably benign	0.00
R6000:Cobl	UTSW	11	12369684	missense	probably benign	0.08
R6373:Cobl	UTSW	11	12253118	missense	probably damaging	1.00
R7034:Cobl	UTSW	11	12254177	missense	probably damaging	1.00
R7077:Cobl	UTSW	11	12253441	missense	probably benign	0.04
R7078:Cobl	UTSW	11	12378271	missense	probably damaging	1.00
R7099:Cobl	UTSW	11	12296540	missense
R7153:Cobl	UTSW	11	12254128	missense	probably damaging	1.00
R7448:Cobl	UTSW	11	12256225	missense	possibly damaging	0.46
R7519:Cobl	UTSW	11	12253124	missense	probably damaging	1.00
R7767:Cobl	UTSW	11	12412117	start gained	probably benign
R7772:Cobl	UTSW	11	12254488	missense	probably benign	0.29

Predicted Primers

PCR Primer
(F):5'- AACTGTGGGGTCTGTTTCAAC -3'
(R):5'- AAACGGGTGCCAATTGGTG -3'

Sequencing Primer
(F):5'- CAACTGGATTCTCATTTTCAGATGTG -3'
(R):5'- TGTCTTTCTCTACAGGAATGGAAG -3'

Posted On

2019-05-15