Incidental Mutation 'R7071:Myo18a'
ID548916
Institutional Source Beutler Lab
Gene Symbol Myo18a
Ensembl Gene ENSMUSG00000000631
Gene Namemyosin XVIIIA
SynonymsMyoPDZ
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location77763246-77865980 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 77823827 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 811 (T811A)
Ref Sequence ENSEMBL: ENSMUSP00000130696 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000645] [ENSMUST00000092884] [ENSMUST00000092887] [ENSMUST00000100794] [ENSMUST00000102488] [ENSMUST00000108375] [ENSMUST00000108376] [ENSMUST00000130305] [ENSMUST00000130627] [ENSMUST00000164334] [ENSMUST00000167856] [ENSMUST00000168348] [ENSMUST00000169105] [ENSMUST00000172303]
Predicted Effect probably damaging
Transcript: ENSMUST00000000645
AA Change: T764A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000645
Gene: ENSMUSG00000000631
AA Change: T764A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1183 1.53e-45 SMART
IQ 1184 1206 1.11e-3 SMART
Pfam:Myosin_tail_1 1219 1867 1.7e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000092884
AA Change: T432A

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090560
Gene: ENSMUSG00000000631
AA Change: T432A

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1534 2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092887
AA Change: T763A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000090563
Gene: ENSMUSG00000000631
AA Change: T763A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000100794
AA Change: T428A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098358
Gene: ENSMUSG00000000631
AA Change: T428A

DomainStartEndE-ValueType
MYSc 68 847 1.45e-46 SMART
IQ 848 870 1.11e-3 SMART
Pfam:Myosin_tail_1 884 1530 4.9e-35 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102488
AA Change: T763A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099546
Gene: ENSMUSG00000000631
AA Change: T763A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1866 3e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000108375
AA Change: T763A

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000104012
Gene: ENSMUSG00000000631
AA Change: T763A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Pfam:Myosin_tail_1 1218 1838 6.8e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108376
AA Change: T763A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104013
Gene: ENSMUSG00000000631
AA Change: T763A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 399 1182 4.16e-47 SMART
IQ 1183 1205 1.11e-3 SMART
Blast:MYSc 1258 1387 1e-14 BLAST
low complexity region 1396 1407 N/A INTRINSIC
low complexity region 1743 1762 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130305
AA Change: T444A

PolyPhen 2 Score 0.451 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000119574
Gene: ENSMUSG00000000631
AA Change: T444A

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130627
AA Change: T775A

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000119839
Gene: ENSMUSG00000000631
AA Change: T775A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1850 6.9e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164334
AA Change: T432A

PolyPhen 2 Score 0.637 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000131771
Gene: ENSMUSG00000000631
AA Change: T432A

DomainStartEndE-ValueType
MYSc 68 851 4.16e-47 SMART
IQ 852 874 1.11e-3 SMART
Pfam:Myosin_tail_1 888 1505 4e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167856
AA Change: T370A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000128487
Gene: ENSMUSG00000000631
AA Change: T370A

DomainStartEndE-ValueType
MYSc 16 789 1.3e-32 SMART
IQ 790 812 1.11e-3 SMART
Blast:MYSc 865 994 1e-14 BLAST
low complexity region 1003 1014 N/A INTRINSIC
low complexity region 1387 1406 N/A INTRINSIC
internal_repeat_1 1569 1627 2.13e-5 PROSPERO
Predicted Effect probably damaging
Transcript: ENSMUST00000168348
AA Change: T811A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130696
Gene: ENSMUSG00000000631
AA Change: T811A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 447 1230 4.16e-47 SMART
IQ 1231 1253 1.11e-3 SMART
Blast:MYSc 1306 1435 1e-14 BLAST
low complexity region 1444 1455 N/A INTRINSIC
low complexity region 1828 1847 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169105
AA Change: T775A

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132149
Gene: ENSMUSG00000000631
AA Change: T775A

DomainStartEndE-ValueType
low complexity region 6 27 N/A INTRINSIC
low complexity region 202 227 N/A INTRINSIC
PDZ 229 311 5.72e-10 SMART
MYSc 411 1194 4.16e-47 SMART
IQ 1195 1217 1.11e-3 SMART
Pfam:Myosin_tail_1 1230 1878 7.3e-35 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000172303
AA Change: T450A

PolyPhen 2 Score 0.687 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000129098
Gene: ENSMUSG00000000631
AA Change: T450A

DomainStartEndE-ValueType
MYSc 80 863 4.16e-47 SMART
IQ 864 886 1.11e-3 SMART
Pfam:Myosin_tail_1 902 1547 2.6e-34 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can bind GOLPH3, linking the Golgi to the cytoskeleton and influencing Golgi membrane trafficking. The encoded protein is also part of a complex that assembles lamellar actomyosin bundles and may be required for cell migration. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Myo18a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Myo18a APN 11 77847938 missense probably damaging 1.00
IGL00753:Myo18a APN 11 77825151 missense probably damaging 1.00
IGL01137:Myo18a APN 11 77827829 missense probably damaging 1.00
IGL01536:Myo18a APN 11 77820851 missense probably damaging 1.00
IGL01642:Myo18a APN 11 77864732 missense probably benign 0.07
IGL01728:Myo18a APN 11 77777856 missense probably damaging 0.99
IGL01780:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02286:Myo18a APN 11 77777985 nonsense probably null
IGL02350:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02357:Myo18a APN 11 77850247 missense probably benign 0.02
IGL02420:Myo18a APN 11 77818693 missense possibly damaging 0.81
IGL02643:Myo18a APN 11 77778172 missense possibly damaging 0.67
IGL02667:Myo18a APN 11 77857852 splice site probably benign
IGL02869:Myo18a APN 11 77864786 missense probably damaging 1.00
IGL02869:Myo18a APN 11 77829873 splice site probably benign
IGL02962:Myo18a APN 11 77778235 missense probably damaging 1.00
IGL02963:Myo18a APN 11 77842018 splice site probably benign
IGL03410:Myo18a APN 11 77848004 missense probably damaging 0.99
IGL03050:Myo18a UTSW 11 77818770 missense probably benign 0.00
R0022:Myo18a UTSW 11 77843233 critical splice donor site probably null
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0064:Myo18a UTSW 11 77847344 missense probably damaging 1.00
R0098:Myo18a UTSW 11 77845765 missense probably damaging 1.00
R0322:Myo18a UTSW 11 77829800 missense probably damaging 1.00
R0373:Myo18a UTSW 11 77821042 missense probably benign 0.01
R0379:Myo18a UTSW 11 77850806 missense possibly damaging 0.84
R0513:Myo18a UTSW 11 77811594 intron probably benign
R0688:Myo18a UTSW 11 77824140 missense probably damaging 1.00
R0734:Myo18a UTSW 11 77847404 missense probably damaging 1.00
R0790:Myo18a UTSW 11 77840709 missense possibly damaging 0.95
R1099:Myo18a UTSW 11 77818901 splice site probably null
R1103:Myo18a UTSW 11 77823330 missense probably damaging 1.00
R1183:Myo18a UTSW 11 77857745 missense probably damaging 1.00
R1216:Myo18a UTSW 11 77818647 missense probably benign 0.35
R1331:Myo18a UTSW 11 77841579 missense probably benign 0.28
R1479:Myo18a UTSW 11 77842194 missense probably benign 0.04
R1723:Myo18a UTSW 11 77853314 missense probably damaging 0.97
R1742:Myo18a UTSW 11 77841467 missense probably damaging 0.99
R1796:Myo18a UTSW 11 77829344 missense possibly damaging 0.94
R1823:Myo18a UTSW 11 77825097 splice site probably benign
R1827:Myo18a UTSW 11 77818771 missense probably benign 0.00
R2033:Myo18a UTSW 11 77843099 splice site probably null
R2043:Myo18a UTSW 11 77823363 missense probably damaging 0.99
R2105:Myo18a UTSW 11 77850234 missense probably benign
R2191:Myo18a UTSW 11 77818615 missense probably damaging 0.99
R2264:Myo18a UTSW 11 77819972 splice site probably benign
R2370:Myo18a UTSW 11 77777770 missense probably benign 0.03
R3015:Myo18a UTSW 11 77859020 intron probably benign
R3433:Myo18a UTSW 11 77818044 intron probably null
R3739:Myo18a UTSW 11 77845615 missense probably damaging 1.00
R3825:Myo18a UTSW 11 77777466 missense possibly damaging 0.47
R4056:Myo18a UTSW 11 77812013 missense possibly damaging 0.72
R4163:Myo18a UTSW 11 77829708 missense possibly damaging 0.72
R4184:Myo18a UTSW 11 77857787 missense probably damaging 1.00
R4620:Myo18a UTSW 11 77817947 missense possibly damaging 0.93
R4628:Myo18a UTSW 11 77824136 missense probably damaging 1.00
R4647:Myo18a UTSW 11 77817950 missense probably damaging 1.00
R4701:Myo18a UTSW 11 77817665 missense probably damaging 1.00
R4729:Myo18a UTSW 11 77777685 unclassified probably null
R4731:Myo18a UTSW 11 77829759 missense probably benign 0.00
R4739:Myo18a UTSW 11 77823323 missense probably damaging 1.00
R4814:Myo18a UTSW 11 77859236 intron probably benign
R4889:Myo18a UTSW 11 77832412 missense probably damaging 1.00
R4988:Myo18a UTSW 11 77845521 critical splice donor site probably null
R5172:Myo18a UTSW 11 77824098 missense probably damaging 1.00
R5177:Myo18a UTSW 11 77864842 utr 3 prime probably benign
R5394:Myo18a UTSW 11 77853350 missense probably benign 0.14
R5643:Myo18a UTSW 11 77854687 missense probably benign 0.12
R5808:Myo18a UTSW 11 77829301 missense probably benign 0.34
R5871:Myo18a UTSW 11 77832480 missense probably damaging 1.00
R5936:Myo18a UTSW 11 77818213 missense probably damaging 1.00
R6017:Myo18a UTSW 11 77841523 missense probably damaging 0.96
R6053:Myo18a UTSW 11 77818176 missense probably damaging 1.00
R6271:Myo18a UTSW 11 77820809 missense probably damaging 1.00
R6486:Myo18a UTSW 11 77864822 missense possibly damaging 0.83
R6558:Myo18a UTSW 11 77850852 missense probably damaging 0.99
R6884:Myo18a UTSW 11 77819049 missense possibly damaging 0.67
R6983:Myo18a UTSW 11 77845515 missense probably benign 0.06
R6993:Myo18a UTSW 11 77859074 intron probably benign
R7074:Myo18a UTSW 11 77842561 missense probably benign 0.03
R7238:Myo18a UTSW 11 77842233 missense probably damaging 0.96
R7328:Myo18a UTSW 11 77807911 missense
R7527:Myo18a UTSW 11 77843580 missense probably benign 0.00
R7598:Myo18a UTSW 11 77847346 missense probably damaging 1.00
R7671:Myo18a UTSW 11 77859420 missense
Y5407:Myo18a UTSW 11 77777815 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- CAAGTAGATGCTTGCAGTGGGAC -3'
(R):5'- GGACACTACCACACAGTGAG -3'

Sequencing Primer
(F):5'- ACAGCCCCAGGACTCTGTG -3'
(R):5'- AGTGAGCCCCGCTTCTCTG -3'
Posted On2019-05-15