Incidental Mutation 'R7071:Ipo11'
ID548920
Institutional Source Beutler Lab
Gene Symbol Ipo11
Ensembl Gene ENSMUSG00000042590
Gene Nameimportin 11
SynonymsRanbp11, 1700081H05Rik, 2510001A17Rik, E330021B14Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location106794439-106936958 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106925096 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 19 (S19C)
Ref Sequence ENSEMBL: ENSMUSP00000079667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080856] [ENSMUST00000186033]
Predicted Effect probably damaging
Transcript: ENSMUST00000080856
AA Change: S19C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000079667
Gene: ENSMUSG00000042590
AA Change: S19C

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 845 856 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186033
AA Change: S19C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140046
Gene: ENSMUSG00000042590
AA Change: S19C

DomainStartEndE-ValueType
IBN_N 28 100 7.71e-12 SMART
low complexity region 375 382 N/A INTRINSIC
low complexity region 563 570 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
Meta Mutation Damage Score 0.1569 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Importins, including IPO11, are a members of the karyopherin/importin-beta family of transport receptors (see KPNB1; 602738) that mediate nucleocytoplasmic transport of protein and RNA cargoes (Plafker and Macara, 2000 [PubMed 11032817]).[supplied by OMIM, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Khsrp C A 17: 57,025,386 M268I possibly damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Ipo11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Ipo11 APN 13 106897260 missense probably damaging 1.00
IGL00900:Ipo11 APN 13 106847444 missense possibly damaging 0.81
IGL00971:Ipo11 APN 13 106856769 missense probably damaging 1.00
IGL01023:Ipo11 APN 13 106897259 missense probably benign 0.44
IGL01331:Ipo11 APN 13 106795746 missense possibly damaging 0.92
IGL01608:Ipo11 APN 13 106834494 intron probably benign
IGL02021:Ipo11 APN 13 106857237 missense probably damaging 1.00
IGL02620:Ipo11 APN 13 106876281 critical splice acceptor site probably null
IGL02651:Ipo11 APN 13 106875606 missense probably damaging 1.00
IGL02699:Ipo11 APN 13 106889397 missense possibly damaging 0.94
IGL02928:Ipo11 APN 13 106889355 splice site probably benign
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0017:Ipo11 UTSW 13 106886730 missense probably benign 0.00
R0032:Ipo11 UTSW 13 106834463 intron probably benign
R0164:Ipo11 UTSW 13 106910194 splice site probably benign
R0333:Ipo11 UTSW 13 106870763 missense probably benign 0.00
R0499:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R0555:Ipo11 UTSW 13 106892461 missense probably damaging 1.00
R0718:Ipo11 UTSW 13 106919611 missense possibly damaging 0.91
R0899:Ipo11 UTSW 13 106900816 nonsense probably null
R1590:Ipo11 UTSW 13 106886717 missense probably damaging 1.00
R1700:Ipo11 UTSW 13 106795662 missense probably benign
R1851:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1852:Ipo11 UTSW 13 106812257 missense possibly damaging 0.73
R1853:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R2012:Ipo11 UTSW 13 106919622 missense probably benign 0.01
R2168:Ipo11 UTSW 13 106879610 splice site probably null
R2183:Ipo11 UTSW 13 106925087 missense probably benign 0.00
R4254:Ipo11 UTSW 13 106892509 missense probably benign 0.00
R4607:Ipo11 UTSW 13 106900811 missense probably damaging 0.98
R4610:Ipo11 UTSW 13 106879737 missense probably benign 0.06
R4654:Ipo11 UTSW 13 106834184 intron probably benign
R4792:Ipo11 UTSW 13 106834160 intron probably benign
R4990:Ipo11 UTSW 13 106860887 missense probably benign 0.19
R5309:Ipo11 UTSW 13 106833973 intron probably benign
R5580:Ipo11 UTSW 13 106900747 missense probably benign
R5822:Ipo11 UTSW 13 106848418 unclassified probably benign
R6459:Ipo11 UTSW 13 106865769 intron probably null
R6597:Ipo11 UTSW 13 106865863 critical splice donor site probably null
R6803:Ipo11 UTSW 13 106857258 missense probably benign
R6882:Ipo11 UTSW 13 106900682 splice site probably null
R7202:Ipo11 UTSW 13 106875570 missense probably damaging 1.00
R7214:Ipo11 UTSW 13 106895857 missense probably null
R7221:Ipo11 UTSW 13 106892557 missense probably damaging 1.00
R7392:Ipo11 UTSW 13 106891691 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCCGTACGTAAATCTCCATAGG -3'
(R):5'- GGCCAGGAGAAAGTGCTTTTC -3'

Sequencing Primer
(F):5'- CTACAGAGTGAGTTCCAGGACTGTC -3'
(R):5'- AAGTGCTTTTCAAACCCTGCAGG -3'
Posted On2019-05-15