Incidental Mutation 'R7071:Khsrp'
ID548923
Institutional Source Beutler Lab
Gene Symbol Khsrp
Ensembl Gene ENSMUSG00000007670
Gene NameKH-type splicing regulatory protein
Synonyms6330409F21Rik, KSRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7071 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location57021058-57031507 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57025386 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 268 (M268I)
Ref Sequence ENSEMBL: ENSMUSP00000007814 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007814] [ENSMUST00000210548]
Predicted Effect possibly damaging
Transcript: ENSMUST00000007814
AA Change: M268I

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000007814
Gene: ENSMUSG00000007670
AA Change: M268I

DomainStartEndE-ValueType
low complexity region 7 69 N/A INTRINSIC
KH 144 214 1.46e-18 SMART
KH 233 305 2.46e-16 SMART
KH 322 392 7.87e-15 SMART
KH 424 497 3.29e-17 SMART
low complexity region 498 547 N/A INTRINSIC
low complexity region 557 579 N/A INTRINSIC
Pfam:DUF1897 610 636 1.8e-8 PFAM
Pfam:DUF1897 666 688 8.5e-10 PFAM
low complexity region 691 710 N/A INTRINSIC
low complexity region 717 727 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210548
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The KHSRP gene encodes a multifunctional RNA-binding protein implicated in a variety of cellular processes, including transcription, alternative pre-mRNA splicing, and mRNA localization (Min et al., 1997 [PubMed 9136930]; Gherzi et al., 2004 [PubMed 15175153]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased susceptibility to HSV-1 infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi3bp C T 16: 56,629,140 Q854* probably null Het
Arl2bp G T 8: 94,667,166 probably benign Het
Astl T C 2: 127,345,965 M121T probably benign Het
Atrip T C 9: 109,067,014 probably null Het
Camk1g A T 1: 193,359,809 V44E probably benign Het
Cc2d2a A G 5: 43,709,113 H804R probably benign Het
Cd300a T C 11: 114,901,273 S314P probably damaging Het
Ceacam5 A T 7: 17,750,652 I440L possibly damaging Het
Cfap61 T G 2: 146,001,912 I306R probably benign Het
Cnot10 T C 9: 114,617,719 probably null Het
Cntln T A 4: 85,100,385 L76Q probably damaging Het
Cobl A G 11: 12,254,795 C636R probably benign Het
Dnm3 A T 1: 162,019,843 H148Q probably damaging Het
Dot1l T A 10: 80,792,245 L1039Q probably benign Het
Faiml T A 9: 99,236,347 M1L unknown Het
Fat1 T G 8: 44,989,108 I1149S possibly damaging Het
Gatad1 T C 5: 3,643,540 R210G probably benign Het
Gm11938 A T 11: 99,603,084 C62S probably damaging Het
Gm15448 A G 7: 3,821,668 S573P unknown Het
Gtf2i A G 5: 134,263,621 L423S probably damaging Het
Hmcn1 A T 1: 150,604,102 C4582S probably damaging Het
Ifitm3 A G 7: 141,010,524 V41A probably benign Het
Ipo11 T A 13: 106,925,096 S19C probably damaging Het
Lrp1b T G 2: 41,408,264 D1036A Het
Mecom T G 3: 29,980,708 H273P probably damaging Het
Mfn1 G A 3: 32,568,395 V601I probably benign Het
Mrps5 T A 2: 127,600,852 Y280* probably null Het
Myo18a A G 11: 77,823,827 T811A probably damaging Het
Ndfip2 A C 14: 105,302,326 N292H possibly damaging Het
Olfr318 C A 11: 58,720,158 V297F possibly damaging Het
Otog T A 7: 46,267,323 C895S probably damaging Het
Pacs1 A T 19: 5,156,374 I261N possibly damaging Het
Ptprn A T 1: 75,260,619 M113K possibly damaging Het
Rag1 T C 2: 101,643,462 H445R probably damaging Het
Ranbp2 T G 10: 58,492,837 F2853V probably damaging Het
Skint5 A T 4: 113,779,080 F647Y unknown Het
Stt3b T C 9: 115,254,017 Y449C probably damaging Het
Ythdc2 A G 18: 44,845,788 D455G probably benign Het
Zfp451 A C 1: 33,776,744 D708E possibly damaging Het
Zfp456 T C 13: 67,372,777 E33G probably damaging Het
Zfp599 T C 9: 22,258,096 T27A probably benign Het
Other mutations in Khsrp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Khsrp APN 17 57023092 missense possibly damaging 0.49
R0973:Khsrp UTSW 17 57025576 missense probably benign
R0973:Khsrp UTSW 17 57025576 missense probably benign
R0974:Khsrp UTSW 17 57025576 missense probably benign
R0975:Khsrp UTSW 17 57027066 missense possibly damaging 0.68
R1080:Khsrp UTSW 17 57024410 frame shift probably null
R1561:Khsrp UTSW 17 57025639 missense probably benign 0.01
R1686:Khsrp UTSW 17 57025597 missense probably benign 0.32
R2133:Khsrp UTSW 17 57027832 missense probably benign 0.17
R2134:Khsrp UTSW 17 57024410 frame shift probably null
R4133:Khsrp UTSW 17 57025605 missense probably benign 0.00
R4819:Khsrp UTSW 17 57023360 missense possibly damaging 0.93
R5213:Khsrp UTSW 17 57024366 missense probably benign 0.17
R5372:Khsrp UTSW 17 57024292 missense possibly damaging 0.95
R6246:Khsrp UTSW 17 57025324 missense possibly damaging 0.45
R6528:Khsrp UTSW 17 57023543 missense probably damaging 0.99
R7141:Khsrp UTSW 17 57025602 missense possibly damaging 0.85
Z1088:Khsrp UTSW 17 57024249 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTGCAAAATGCCTTACAGAG -3'
(R):5'- GTGCAGGAGATCATGATCCC -3'

Sequencing Primer
(F):5'- TTTTCACCCTGGGCAAGAG -3'
(R):5'- AGATCATGATCCCTGCTGGCAAG -3'
Posted On2019-05-15