Incidental Mutation 'R7072:Abca4'
ID548942
Institutional Source Beutler Lab
Gene Symbol Abca4
Ensembl Gene ENSMUSG00000028125
Gene NameATP-binding cassette, sub-family A (ABC1), member 4
SynonymsD430003I15Rik, Abc10, Rim protein, RmP
MMRRC Submission
Accession Numbers

Genbank: NM_007378; MGI: 109424

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7072 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location122044443-122180123 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 122173943 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 2214 (L2214Q)
Ref Sequence ENSEMBL: ENSMUSP00000013995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013995] [ENSMUST00000141135]
Predicted Effect probably damaging
Transcript: ENSMUST00000013995
AA Change: L2214Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000013995
Gene: ENSMUSG00000028125
AA Change: L2214Q

DomainStartEndE-ValueType
transmembrane domain 23 42 N/A INTRINSIC
Pfam:ABC2_membrane_3 608 856 5e-17 PFAM
AAA 955 1145 9.42e-13 SMART
transmembrane domain 1372 1394 N/A INTRINSIC
Pfam:ABC2_membrane_3 1522 1894 2.9e-44 PFAM
AAA 1963 2147 7.09e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000141135
AA Change: L1006Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143560
Gene: ENSMUSG00000028125
AA Change: L1006Q

DomainStartEndE-ValueType
Blast:AAA 1 172 9e-78 BLAST
Pfam:ABC2_membrane_3 311 686 1.9e-42 PFAM
AAA 755 939 1.2e-9 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This protein was the first of the ABC transporters to be observed in photoreceptors and may play a role in the photoresponse. Mutations in the human gene are found in patients diagnosed with Stargardt disease and are associated with retinitis pigmentosa-19 and macular degeneration age-related 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene display delayed rod dark adaptation and are a model for juvenile macular degeneration. [provided by MGI curators]
Allele List at MGI

All alleles(8) : Targeted, knock-out(2) Targeted, other(2) Gene trapped(4)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 S1280T probably damaging Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Csnk1e C T 15: 79,438,767 probably null Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Dyrk3 A T 1: 131,129,728 L236Q probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gcc2 A G 10: 58,270,927 T662A probably benign Het
Gins1 C T 2: 150,909,751 probably null Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Olfr753-ps1 A G 17: 37,170,378 I90T probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Plcg2 T A 8: 117,589,835 probably null Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sec24d A G 3: 123,330,351 D403G probably damaging Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Slc39a4 T C 15: 76,613,258 T485A probably damaging Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Abca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Abca4 APN 3 122062704 splice site probably null
IGL00229:Abca4 APN 3 122170954 missense probably damaging 1.00
IGL00858:Abca4 APN 3 122173888 missense probably damaging 0.97
IGL01316:Abca4 APN 3 122141755 missense probably damaging 0.99
IGL01357:Abca4 APN 3 122103583 missense probably damaging 1.00
IGL01784:Abca4 APN 3 122138505 missense probably benign 0.22
IGL01903:Abca4 APN 3 122155401 splice site probably benign
IGL02008:Abca4 APN 3 122176101 missense probably benign 0.00
IGL02113:Abca4 APN 3 122110478 missense possibly damaging 0.90
IGL02142:Abca4 APN 3 122169926 missense probably benign 0.01
IGL02200:Abca4 APN 3 122069014 missense probably benign 0.00
IGL02203:Abca4 APN 3 122179808 missense probably benign
IGL02306:Abca4 APN 3 122158395 missense probably damaging 1.00
IGL02307:Abca4 APN 3 122141746 missense probably damaging 1.00
IGL02673:Abca4 APN 3 122103501 missense probably damaging 1.00
IGL02864:Abca4 APN 3 122143431 missense probably damaging 1.00
IGL02886:Abca4 APN 3 122128214 missense probably damaging 0.96
IGL02934:Abca4 APN 3 122162359 nonsense probably null
IGL02992:Abca4 APN 3 122128286 missense probably damaging 0.96
IGL03083:Abca4 APN 3 122138612 critical splice donor site probably null
IGL03258:Abca4 APN 3 122137561 splice site probably benign
IGL03279:Abca4 APN 3 122141732 missense probably benign 0.12
3-1:Abca4 UTSW 3 122080925 missense probably benign 0.01
B6819:Abca4 UTSW 3 122103624 splice site probably benign
K7894:Abca4 UTSW 3 122147868 frame shift probably null
PIT4151001:Abca4 UTSW 3 122137021 missense probably damaging 0.99
PIT4453001:Abca4 UTSW 3 122105316 missense probably damaging 0.99
R0001:Abca4 UTSW 3 122081011 splice site probably benign
R0091:Abca4 UTSW 3 122138530 missense possibly damaging 0.94
R0138:Abca4 UTSW 3 122105449 missense probably damaging 1.00
R0344:Abca4 UTSW 3 122083964 missense probably damaging 1.00
R0347:Abca4 UTSW 3 122120099 missense probably benign 0.00
R0508:Abca4 UTSW 3 122123551 splice site probably benign
R0607:Abca4 UTSW 3 122156432 missense probably damaging 1.00
R0835:Abca4 UTSW 3 122126213 missense probably damaging 1.00
R0839:Abca4 UTSW 3 122126878 missense probably damaging 0.99
R1138:Abca4 UTSW 3 122173848 missense probably benign 0.13
R1448:Abca4 UTSW 3 122162928 splice site probably null
R1453:Abca4 UTSW 3 122069114 missense probably benign 0.04
R1533:Abca4 UTSW 3 122135158 missense probably benign 0.07
R1645:Abca4 UTSW 3 122155277 missense probably benign 0.00
R1763:Abca4 UTSW 3 122110681 missense probably benign 0.09
R1763:Abca4 UTSW 3 122163830 missense probably damaging 1.00
R1838:Abca4 UTSW 3 122128305 missense probably benign
R1867:Abca4 UTSW 3 122105361 missense probably damaging 1.00
R1907:Abca4 UTSW 3 122069012 missense probably damaging 0.99
R1935:Abca4 UTSW 3 122052923 missense probably benign 0.00
R1936:Abca4 UTSW 3 122052923 missense probably benign 0.00
R2165:Abca4 UTSW 3 122112399 missense possibly damaging 0.90
R2391:Abca4 UTSW 3 122158422 missense probably benign 0.00
R2403:Abca4 UTSW 3 122170943 missense probably damaging 1.00
R3788:Abca4 UTSW 3 122052912 missense possibly damaging 0.50
R3814:Abca4 UTSW 3 122170921 splice site probably benign
R4554:Abca4 UTSW 3 122156343 missense possibly damaging 0.91
R4649:Abca4 UTSW 3 122169893 missense probably damaging 1.00
R4653:Abca4 UTSW 3 122138581 nonsense probably null
R4655:Abca4 UTSW 3 122147498 missense possibly damaging 0.93
R4668:Abca4 UTSW 3 122155299 missense possibly damaging 0.90
R4705:Abca4 UTSW 3 122105370 missense probably damaging 0.98
R4788:Abca4 UTSW 3 122166712 missense probably damaging 1.00
R4795:Abca4 UTSW 3 122176123 missense probably damaging 0.99
R4999:Abca4 UTSW 3 122105370 missense probably damaging 1.00
R5301:Abca4 UTSW 3 122102853 missense probably damaging 0.96
R5372:Abca4 UTSW 3 122055339 missense probably damaging 0.96
R5395:Abca4 UTSW 3 122080941 missense probably benign 0.00
R5539:Abca4 UTSW 3 122169908 missense probably damaging 1.00
R5583:Abca4 UTSW 3 122148901 missense probably damaging 0.99
R5706:Abca4 UTSW 3 122054261 missense probably benign 0.10
R5719:Abca4 UTSW 3 122135266 critical splice donor site probably null
R5731:Abca4 UTSW 3 122132593 missense probably damaging 1.00
R5802:Abca4 UTSW 3 122054232 missense probably damaging 1.00
R5819:Abca4 UTSW 3 122136981 missense probably damaging 0.97
R5853:Abca4 UTSW 3 122103531 missense probably benign
R6053:Abca4 UTSW 3 122171017 missense probably damaging 0.99
R6135:Abca4 UTSW 3 122138447 missense possibly damaging 0.69
R6185:Abca4 UTSW 3 122126140 missense probably damaging 0.97
R6227:Abca4 UTSW 3 122137094 nonsense probably null
R6293:Abca4 UTSW 3 122141746 missense probably damaging 1.00
R6297:Abca4 UTSW 3 122132530 missense probably benign 0.24
R6367:Abca4 UTSW 3 122103580 missense probably damaging 1.00
R6376:Abca4 UTSW 3 122123660 missense possibly damaging 0.95
R6405:Abca4 UTSW 3 122173662 splice site probably null
R6525:Abca4 UTSW 3 122137659 missense probably benign 0.00
R6602:Abca4 UTSW 3 122138501 missense probably benign 0.00
R6681:Abca4 UTSW 3 122121798 missense probably damaging 1.00
R6747:Abca4 UTSW 3 122126313 splice site probably null
R6852:Abca4 UTSW 3 122135195 missense probably damaging 0.99
R7049:Abca4 UTSW 3 122147848 missense probably benign 0.00
R7092:Abca4 UTSW 3 122138569 missense probably damaging 1.00
R7110:Abca4 UTSW 3 122132643 missense probably damaging 1.00
R7138:Abca4 UTSW 3 122105464 nonsense probably null
R7172:Abca4 UTSW 3 122103540 nonsense probably null
R7263:Abca4 UTSW 3 122054194 missense probably damaging 0.99
R7414:Abca4 UTSW 3 122102738 missense probably benign 0.28
R7537:Abca4 UTSW 3 122173988 missense possibly damaging 0.68
R7577:Abca4 UTSW 3 122174014 missense probably damaging 1.00
R7665:Abca4 UTSW 3 122044490 start gained probably benign
R7758:Abca4 UTSW 3 122128167 missense probably damaging 1.00
R7935:Abca4 UTSW 3 122110537 missense possibly damaging 0.85
R8237:Abca4 UTSW 3 122162303 missense probably benign 0.00
R8255:Abca4 UTSW 3 122155277 missense probably benign 0.00
R8294:Abca4 UTSW 3 122103568 missense possibly damaging 0.75
R8504:Abca4 UTSW 3 122129334 missense probably benign 0.01
R8536:Abca4 UTSW 3 122179745 missense probably benign 0.01
Z1176:Abca4 UTSW 3 122103488 missense probably damaging 1.00
Z1176:Abca4 UTSW 3 122156443 missense probably damaging 1.00
Z1177:Abca4 UTSW 3 122147786 missense possibly damaging 0.79
Z1177:Abca4 UTSW 3 122173914 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- TTGCCTTAGCTCTTACAGAACTG -3'
(R):5'- CTGCATTAAAGCGAGGGCATC -3'

Sequencing Primer
(F):5'- TGAACACACTGTGCACTTGCTAG -3'
(R):5'- ATCCTGCCTGCCTTCCACG -3'
Posted On2019-05-15