Incidental Mutation 'R7072:Gcc2'
ID548974
Institutional Source Beutler Lab
Gene Symbol Gcc2
Ensembl Gene ENSMUSG00000038039
Gene NameGRIP and coiled-coil domain containing 2
Synonyms2600014C01Rik, 0610043A03Rik, 2210420P05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R7072 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location58255497-58305599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58270927 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 662 (T662A)
Ref Sequence ENSEMBL: ENSMUSP00000054033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057659] [ENSMUST00000160416] [ENSMUST00000160427] [ENSMUST00000162041] [ENSMUST00000162860] [ENSMUST00000162984]
Predicted Effect probably benign
Transcript: ENSMUST00000057659
AA Change: T662A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054033
Gene: ENSMUSG00000038039
AA Change: T662A

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
coiled coil region 33 282 N/A INTRINSIC
internal_repeat_2 353 378 3.94e-5 PROSPERO
internal_repeat_2 382 406 3.94e-5 PROSPERO
coiled coil region 790 882 N/A INTRINSIC
low complexity region 939 964 N/A INTRINSIC
internal_repeat_1 1093 1111 1.93e-5 PROSPERO
low complexity region 1115 1132 N/A INTRINSIC
low complexity region 1179 1190 N/A INTRINSIC
coiled coil region 1441 1470 N/A INTRINSIC
internal_repeat_1 1554 1572 1.93e-5 PROSPERO
Grip 1608 1655 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160416
SMART Domains Protein: ENSMUSP00000123873
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 37 176 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160427
SMART Domains Protein: ENSMUSP00000124411
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
coiled coil region 32 94 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162041
AA Change: T626A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000124787
Gene: ENSMUSG00000038039
AA Change: T626A

DomainStartEndE-ValueType
coiled coil region 32 246 N/A INTRINSIC
internal_repeat_2 317 342 3.28e-5 PROSPERO
internal_repeat_2 346 370 3.28e-5 PROSPERO
coiled coil region 754 846 N/A INTRINSIC
low complexity region 903 928 N/A INTRINSIC
internal_repeat_1 1057 1075 1.6e-5 PROSPERO
low complexity region 1079 1096 N/A INTRINSIC
low complexity region 1143 1154 N/A INTRINSIC
coiled coil region 1405 1434 N/A INTRINSIC
internal_repeat_1 1518 1536 1.6e-5 PROSPERO
Grip 1572 1619 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162860
AA Change: T562A

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000124152
Gene: ENSMUSG00000038039
AA Change: T562A

DomainStartEndE-ValueType
coiled coil region 46 182 N/A INTRINSIC
internal_repeat_2 253 278 4.17e-5 PROSPERO
internal_repeat_2 282 306 4.17e-5 PROSPERO
coiled coil region 690 782 N/A INTRINSIC
low complexity region 839 864 N/A INTRINSIC
internal_repeat_1 993 1011 2.06e-5 PROSPERO
low complexity region 1015 1032 N/A INTRINSIC
low complexity region 1079 1090 N/A INTRINSIC
coiled coil region 1341 1370 N/A INTRINSIC
internal_repeat_1 1450 1468 2.06e-5 PROSPERO
Grip 1504 1551 4.37e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162984
SMART Domains Protein: ENSMUSP00000124988
Gene: ENSMUSG00000038039

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a peripheral membrane protein localized to the trans-Golgi network. It is sensitive to brefeldin A. This encoded protein contains a GRIP domain which is thought to be used in targeting. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,173,943 L2214Q probably damaging Het
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 S1280T probably damaging Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Csnk1e C T 15: 79,438,767 probably null Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Dyrk3 A T 1: 131,129,728 L236Q probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gins1 C T 2: 150,909,751 probably null Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Olfr753-ps1 A G 17: 37,170,378 I90T probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Plcg2 T A 8: 117,589,835 probably null Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sec24d A G 3: 123,330,351 D403G probably damaging Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Slc39a4 T C 15: 76,613,258 T485A probably damaging Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Gcc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Gcc2 APN 10 58292680 missense probably damaging 1.00
IGL00850:Gcc2 APN 10 58258248 missense probably benign 0.00
IGL00935:Gcc2 APN 10 58278779 splice site probably benign
IGL01551:Gcc2 APN 10 58298869 splice site probably benign
IGL01642:Gcc2 APN 10 58280612 missense probably benign 0.00
IGL02041:Gcc2 APN 10 58269281 missense probably damaging 1.00
IGL02215:Gcc2 APN 10 58271636 missense probably benign 0.36
IGL02448:Gcc2 APN 10 58292571 nonsense probably null
IGL02698:Gcc2 APN 10 58271290 missense possibly damaging 0.76
IGL02888:Gcc2 APN 10 58294828 missense probably damaging 1.00
IGL02936:Gcc2 APN 10 58296140 missense probably damaging 1.00
IGL03223:Gcc2 APN 10 58298734 missense probably damaging 1.00
IGL03249:Gcc2 APN 10 58270992 nonsense probably null
R0179:Gcc2 UTSW 10 58276650 missense probably benign 0.39
R0528:Gcc2 UTSW 10 58298689 missense probably damaging 1.00
R1569:Gcc2 UTSW 10 58270171 missense probably benign 0.00
R1606:Gcc2 UTSW 10 58269448 missense probably damaging 1.00
R1725:Gcc2 UTSW 10 58304115 missense possibly damaging 0.95
R1916:Gcc2 UTSW 10 58276663 missense probably damaging 1.00
R1956:Gcc2 UTSW 10 58286143 missense possibly damaging 0.66
R2058:Gcc2 UTSW 10 58285957 missense probably benign 0.10
R2114:Gcc2 UTSW 10 58269540 nonsense probably null
R2280:Gcc2 UTSW 10 58269680 missense probably benign 0.38
R2435:Gcc2 UTSW 10 58294780 missense probably damaging 1.00
R2876:Gcc2 UTSW 10 58290302 missense probably damaging 0.99
R4753:Gcc2 UTSW 10 58290382 missense probably benign 0.20
R4827:Gcc2 UTSW 10 58286131 critical splice acceptor site probably null
R4911:Gcc2 UTSW 10 58270439 missense probably damaging 1.00
R5033:Gcc2 UTSW 10 58278806 missense probably damaging 0.98
R5224:Gcc2 UTSW 10 58286160 missense probably damaging 1.00
R5271:Gcc2 UTSW 10 58269695 missense possibly damaging 0.46
R5398:Gcc2 UTSW 10 58269507 missense probably benign 0.00
R5411:Gcc2 UTSW 10 58270969 missense probably damaging 0.99
R5594:Gcc2 UTSW 10 58287242 missense probably damaging 0.99
R5825:Gcc2 UTSW 10 58294821 missense probably damaging 1.00
R5974:Gcc2 UTSW 10 58258243 missense probably damaging 0.99
R5987:Gcc2 UTSW 10 58255847 utr 5 prime probably benign
R6195:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6198:Gcc2 UTSW 10 58292590 missense probably benign 0.26
R6233:Gcc2 UTSW 10 58270984 missense probably damaging 0.96
R6331:Gcc2 UTSW 10 58271465 missense probably benign
R6349:Gcc2 UTSW 10 58269474 missense probably benign 0.01
R6593:Gcc2 UTSW 10 58271507 missense probably damaging 1.00
R6632:Gcc2 UTSW 10 58270049 splice site probably null
R6647:Gcc2 UTSW 10 58287281 critical splice donor site probably null
R6774:Gcc2 UTSW 10 58281439 missense possibly damaging 0.94
R6808:Gcc2 UTSW 10 58258242 missense probably damaging 0.99
R7220:Gcc2 UTSW 10 58280594 missense probably benign 0.00
R7352:Gcc2 UTSW 10 58280698 critical splice donor site probably null
R7384:Gcc2 UTSW 10 58269964 missense probably damaging 1.00
R7439:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7441:Gcc2 UTSW 10 58256901 missense probably benign 0.08
R7543:Gcc2 UTSW 10 58271264 missense probably benign 0.02
R7843:Gcc2 UTSW 10 58268021 missense possibly damaging 0.77
R7850:Gcc2 UTSW 10 58278881 missense probably damaging 0.96
R7980:Gcc2 UTSW 10 58278752 splice site probably null
R8336:Gcc2 UTSW 10 58272367 missense probably damaging 0.99
X0018:Gcc2 UTSW 10 58278814 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGTACTTAGCCAGTCTTGGTC -3'
(R):5'- GGAGTTTCTTTTCGAATTCAGCAAC -3'

Sequencing Primer
(F):5'- GCCAGTCTTGGTCAAAAAGATAC -3'
(R):5'- CAGCAACATGTTCTTTATGGGC -3'
Posted On2019-05-15