Incidental Mutation 'R7072:Slc39a4'
ID548990
Institutional Source Beutler Lab
Gene Symbol Slc39a4
Ensembl Gene ENSMUSG00000063354
Gene Namesolute carrier family 39 (zinc transporter), member 4
SynonymsAWMS2, zip4, 1600025H15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7072 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location76612383-76617384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76613258 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 485 (T485A)
Ref Sequence ENSEMBL: ENSMUSP00000073134 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073428] [ENSMUST00000230977]
Predicted Effect probably damaging
Transcript: ENSMUST00000073428
AA Change: T485A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073134
Gene: ENSMUSG00000063354
AA Change: T485A

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
low complexity region 238 253 N/A INTRINSIC
Pfam:Zip 335 652 3.5e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000230977
AA Change: T538A

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc/iron-regulated transporter-like protein (ZIP) family. The encoded protein localizes to cell membranes and is required for zinc uptake in the intestine. Mutations in this gene result in acrodermatitis enteropathica. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic letahlity around E10. Mice heterozygous for a null allele exhibit developmental defects similar to the teratology of zinc deficiency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,173,943 L2214Q probably damaging Het
Acbd3 T C 1: 180,726,369 F90L probably benign Het
Ahnak2 T A 12: 112,788,166 Q23L Het
Anpep A T 7: 79,835,379 L620I possibly damaging Het
Bpi T C 2: 158,272,078 S299P probably damaging Het
Bpifa2 A G 2: 154,011,373 D132G probably damaging Het
Brd7 T A 8: 88,346,987 E258D probably benign Het
Btc T C 5: 91,402,937 probably benign Het
Cacna1c A G 6: 118,596,106 V2039A Het
Calm4 T A 13: 3,838,275 V127E probably benign Het
Casp8ap2 T A 4: 32,644,766 S1280T probably damaging Het
Cc2d2b T C 19: 40,760,359 V80A unknown Het
Ccdc33 A G 9: 58,111,984 *279R probably null Het
Cercam T A 2: 29,881,924 H585Q probably benign Het
Cnnm1 A G 19: 43,440,857 D138G probably benign Het
Cox4i2 T C 2: 152,760,653 F89S probably damaging Het
Crb1 G A 1: 139,237,275 T1098I probably damaging Het
Csnk1e C T 15: 79,438,767 probably null Het
Ctsj C A 13: 61,003,083 E187* probably null Het
D730001G18Rik C T 15: 74,772,270 V66M Het
Dagla A T 19: 10,256,295 probably null Het
Dnah7a G A 1: 53,419,753 T3742I probably benign Het
Dnajc6 A C 4: 101,615,615 H381P probably damaging Het
Dyrk3 A T 1: 131,129,728 L236Q probably damaging Het
Edc4 T A 8: 105,888,002 D105E probably damaging Het
Frmd5 A T 2: 121,557,870 L241Q probably damaging Het
Gcc2 A G 10: 58,270,927 T662A probably benign Het
Gins1 C T 2: 150,909,751 probably null Het
Gli3 T A 13: 15,725,695 N1222K possibly damaging Het
Gm15922 C G 7: 3,737,320 A301P probably damaging Het
Gm4302 G T 10: 100,341,659 Q268H unknown Het
Grin2d A T 7: 45,857,498 W518R probably damaging Het
Grm5 A T 7: 88,074,304 I601F probably damaging Het
Gtpbp10 A T 5: 5,546,365 N193K probably benign Het
Igdcc4 T G 9: 65,130,731 V798G probably damaging Het
Igkv8-19 A T 6: 70,341,412 F13I probably benign Het
Kctd11 T A 11: 69,879,795 N139I probably benign Het
Lmo7 G A 14: 101,898,700 probably null Het
Lrrk2 A T 15: 91,801,920 M2155L probably benign Het
Mettl24 A C 10: 40,683,513 H53P probably benign Het
Mier2 A G 10: 79,540,299 M264T unknown Het
Mplkip T C 13: 17,695,537 I18T unknown Het
Mtmr2 T C 9: 13,788,620 V101A probably benign Het
Nbeal2 G T 9: 110,626,051 T2593K probably benign Het
Neu3 A T 7: 99,814,197 C106* probably null Het
Nutm1 T C 2: 112,251,847 T295A probably benign Het
Olfr753-ps1 A G 17: 37,170,378 I90T probably benign Het
Pcdhga7 G T 18: 37,717,276 V779L probably benign Het
Pde10a A G 17: 8,943,026 E231G probably benign Het
Plcg2 T A 8: 117,589,835 probably null Het
Pofut2 T C 10: 77,259,429 L36P probably benign Het
Pou6f2 T C 13: 18,125,169 N635S Het
Pramef17 A C 4: 143,994,128 I81R probably damaging Het
Ptpra T C 2: 130,553,430 Y818H probably damaging Het
Rad18 T C 6: 112,681,440 E168G probably benign Het
Rev1 C A 1: 38,067,545 E634* probably null Het
Sec24d A G 3: 123,330,351 D403G probably damaging Het
Sema5a C A 15: 32,574,959 H404Q possibly damaging Het
Shank1 A G 7: 44,344,946 S844G unknown Het
Slc32a1 T A 2: 158,611,496 Y85* probably null Het
Sp5 A C 2: 70,476,730 Q253P probably benign Het
Sspo A T 6: 48,454,979 D709V probably damaging Het
Sucnr1 A G 3: 60,086,183 Y44C probably damaging Het
Taar8b A G 10: 24,091,978 L106P possibly damaging Het
Tbc1d9 A G 8: 83,264,865 D922G probably damaging Het
Tbx6 A T 7: 126,784,740 D322V probably benign Het
Tex15 T A 8: 33,575,431 S1630T possibly damaging Het
Ube2o G A 11: 116,541,501 P880S probably benign Het
Uck1 C T 2: 32,258,166 R182Q probably damaging Het
Utrn T A 10: 12,465,213 H2840L probably damaging Het
Vps8 A G 16: 21,581,579 T1266A probably benign Het
Wnk1 A T 6: 119,937,861 I1909N unknown Het
Zfp352 C T 4: 90,224,424 T267I probably benign Het
Zfp773 A T 7: 7,132,875 C241S probably benign Het
Zfp934 T C 13: 62,520,525 D8G probably damaging Het
Other mutations in Slc39a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02558:Slc39a4 APN 15 76614203 missense probably damaging 1.00
IGL02597:Slc39a4 APN 15 76613624 missense probably benign
IGL02798:Slc39a4 APN 15 76615182 missense probably benign 0.04
texline UTSW 15 76614083 missense probably damaging 1.00
R0519:Slc39a4 UTSW 15 76615138 missense probably benign 0.38
R0815:Slc39a4 UTSW 15 76612639 missense probably damaging 1.00
R1502:Slc39a4 UTSW 15 76616593 missense probably benign 0.00
R1547:Slc39a4 UTSW 15 76614147 nonsense probably null
R2919:Slc39a4 UTSW 15 76616670 missense probably damaging 1.00
R4634:Slc39a4 UTSW 15 76614493 missense probably benign
R5029:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5030:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R5669:Slc39a4 UTSW 15 76614163 missense probably damaging 1.00
R6020:Slc39a4 UTSW 15 76616142 missense probably benign 0.03
R6741:Slc39a4 UTSW 15 76614083 missense probably damaging 1.00
R6920:Slc39a4 UTSW 15 76613270 missense probably damaging 0.99
RF035:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF039:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF040:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF041:Slc39a4 UTSW 15 76614866 small insertion probably benign
RF042:Slc39a4 UTSW 15 76614871 small insertion probably benign
RF043:Slc39a4 UTSW 15 76614870 small insertion probably benign
RF044:Slc39a4 UTSW 15 76614870 small insertion probably benign
Z1176:Slc39a4 UTSW 15 76614173 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCACATGCCTCTCTCATAGAAAG -3'
(R):5'- CGGAACTACTGAACCCAGAG -3'

Sequencing Primer
(F):5'- ATGCCTCTCTCATAGAAAGGCCTTG -3'
(R):5'- ACTGAGAGCAGGTGAGCCC -3'
Posted On2019-05-15