Incidental Mutation 'R7073:Ash1l'
ID549010
Institutional Source Beutler Lab
Gene Symbol Ash1l
Ensembl Gene ENSMUSG00000028053
Gene NameASH1 like histone lysine methyltransferase
Synonymschromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
MMRRC Submission
Accession Numbers

Genbank: NM_138679; MGI: 2183158

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location88950622-89079375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 88985340 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1509 (E1509K)
Ref Sequence ENSEMBL: ENSMUSP00000088451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090933] [ENSMUST00000186583]
Predicted Effect probably damaging
Transcript: ENSMUST00000090933
AA Change: E1509K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088451
Gene: ENSMUSG00000028053
AA Change: E1509K

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186583
AA Change: E1509K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140251
Gene: ENSMUSG00000028053
AA Change: E1509K

DomainStartEndE-ValueType
low complexity region 36 46 N/A INTRINSIC
low complexity region 226 237 N/A INTRINSIC
internal_repeat_1 238 306 6.88e-12 PROSPERO
internal_repeat_1 306 406 6.88e-12 PROSPERO
low complexity region 552 571 N/A INTRINSIC
low complexity region 706 717 N/A INTRINSIC
low complexity region 745 753 N/A INTRINSIC
low complexity region 777 791 N/A INTRINSIC
AT_hook 823 835 3.06e2 SMART
low complexity region 859 873 N/A INTRINSIC
AT_hook 885 897 9.15e0 SMART
low complexity region 938 948 N/A INTRINSIC
low complexity region 1086 1105 N/A INTRINSIC
low complexity region 1107 1121 N/A INTRINSIC
low complexity region 1159 1173 N/A INTRINSIC
low complexity region 1262 1273 N/A INTRINSIC
low complexity region 1288 1301 N/A INTRINSIC
AT_hook 1345 1357 3.09e-1 SMART
low complexity region 1377 1388 N/A INTRINSIC
low complexity region 1395 1424 N/A INTRINSIC
low complexity region 1478 1491 N/A INTRINSIC
low complexity region 1678 1692 N/A INTRINSIC
AT_hook 1843 1855 1.03e1 SMART
low complexity region 1971 1983 N/A INTRINSIC
AWS 2081 2133 3.95e-26 SMART
SET 2135 2257 8.04e-45 SMART
PostSET 2259 2275 6.38e-2 SMART
low complexity region 2296 2316 N/A INTRINSIC
BROMO 2431 2541 8.29e-23 SMART
low complexity region 2549 2563 N/A INTRINSIC
PHD 2576 2618 8.25e-6 SMART
BAH 2650 2787 1.18e-23 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trithorax group of transcriptional activators. The protein contains four AT hooks, a SET domain, a PHD-finger motif, and a bromodomain. It is localized to many small speckles in the nucleus, and also to cell-cell tight junctions. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a transposon-induced allele are more susceptible to endotoxin shock, sepsis, and autoimmune disease. Homozygotes for a hypomorphic allele show reduced growth and postnatal lethality; surviving adults lack Meibomian glands and show vertebral, reproductive organ, and fertility defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Ash1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Ash1l APN 3 88981712 missense probably benign 0.19
IGL00819:Ash1l APN 3 89007736 missense possibly damaging 0.68
IGL00939:Ash1l APN 3 89035236 missense probably damaging 0.99
IGL01064:Ash1l APN 3 89072484 missense probably damaging 1.00
IGL01066:Ash1l APN 3 88984635 missense probably damaging 1.00
IGL01087:Ash1l APN 3 89063902 missense probably damaging 1.00
IGL01293:Ash1l APN 3 88983529 missense probably benign 0.01
IGL01541:Ash1l APN 3 89066265 missense probably damaging 1.00
IGL01863:Ash1l APN 3 88985506 nonsense probably null
IGL02326:Ash1l APN 3 88966057 missense probably benign 0.00
IGL02407:Ash1l APN 3 89072548 missense probably damaging 1.00
IGL02419:Ash1l APN 3 88985565 missense probably benign 0.00
IGL02422:Ash1l APN 3 89069079 critical splice donor site probably null
IGL02494:Ash1l APN 3 89066218 nonsense probably null
IGL02727:Ash1l APN 3 89023037 missense probably benign
IGL02732:Ash1l APN 3 88966228 missense probably damaging 1.00
IGL02817:Ash1l APN 3 88984801 missense probably damaging 1.00
IGL02887:Ash1l APN 3 88984181 missense probably benign 0.11
IGL03224:Ash1l APN 3 89035268 splice site probably benign
IGL03253:Ash1l APN 3 88984674 missense probably damaging 1.00
IGL03327:Ash1l APN 3 89023083 missense probably benign 0.02
IGL03398:Ash1l APN 3 89007220 missense probably benign 0.01
3-1:Ash1l UTSW 3 88966326 missense probably benign
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0068:Ash1l UTSW 3 89007317 missense probably benign 0.17
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0239:Ash1l UTSW 3 89067222 missense possibly damaging 0.49
R0395:Ash1l UTSW 3 89058589 missense probably damaging 1.00
R0477:Ash1l UTSW 3 88983459 missense probably benign 0.41
R0528:Ash1l UTSW 3 88982277 missense probably benign
R0543:Ash1l UTSW 3 89063778 splice site probably null
R0855:Ash1l UTSW 3 89054454 missense possibly damaging 0.82
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1147:Ash1l UTSW 3 88984887 missense possibly damaging 0.72
R1163:Ash1l UTSW 3 89035263 critical splice donor site probably null
R1196:Ash1l UTSW 3 88983316 missense probably damaging 0.99
R1419:Ash1l UTSW 3 88984897 missense probably damaging 0.99
R1445:Ash1l UTSW 3 89007352 missense probably benign 0.02
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1466:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1480:Ash1l UTSW 3 88985052 missense probably damaging 1.00
R1506:Ash1l UTSW 3 89058499 missense probably damaging 0.99
R1537:Ash1l UTSW 3 89072476 missense probably damaging 0.99
R1584:Ash1l UTSW 3 89052065 missense probably damaging 1.00
R1669:Ash1l UTSW 3 89067242 critical splice donor site probably null
R1713:Ash1l UTSW 3 89076224 missense probably damaging 1.00
R1780:Ash1l UTSW 3 88965984 missense probably benign
R1793:Ash1l UTSW 3 89070309 missense probably damaging 1.00
R1881:Ash1l UTSW 3 88981555 missense probably benign 0.00
R1909:Ash1l UTSW 3 88984528 missense probably benign 0.29
R1938:Ash1l UTSW 3 88984422 missense probably damaging 0.98
R2035:Ash1l UTSW 3 89066317 missense probably benign 0.00
R2070:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2071:Ash1l UTSW 3 88966203 missense probably damaging 1.00
R2114:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2116:Ash1l UTSW 3 88983264 missense probably benign 0.00
R2118:Ash1l UTSW 3 88985295 missense possibly damaging 0.80
R2143:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2164:Ash1l UTSW 3 88985419 missense probably benign 0.09
R2210:Ash1l UTSW 3 89066298 missense probably damaging 1.00
R2247:Ash1l UTSW 3 89007367 missense possibly damaging 0.77
R2303:Ash1l UTSW 3 89026426 missense probably damaging 1.00
R2860:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R2861:Ash1l UTSW 3 89054478 missense probably damaging 1.00
R3104:Ash1l UTSW 3 89054386 missense probably damaging 1.00
R4133:Ash1l UTSW 3 88982260 missense probably benign 0.00
R4164:Ash1l UTSW 3 88981966 missense probably damaging 0.97
R4270:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4271:Ash1l UTSW 3 88982040 missense probably benign 0.26
R4287:Ash1l UTSW 3 89066415 missense probably damaging 0.99
R4409:Ash1l UTSW 3 89007199 missense probably damaging 0.99
R4459:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R4487:Ash1l UTSW 3 88985315 missense possibly damaging 0.65
R4674:Ash1l UTSW 3 89072476 missense possibly damaging 0.80
R4739:Ash1l UTSW 3 88982845 missense probably benign 0.19
R4927:Ash1l UTSW 3 88985334 missense probably damaging 1.00
R5000:Ash1l UTSW 3 89058634 missense probably damaging 1.00
R5016:Ash1l UTSW 3 88982323 missense probably damaging 1.00
R5055:Ash1l UTSW 3 89023212 critical splice donor site probably null
R5081:Ash1l UTSW 3 88984717 missense probably damaging 1.00
R5082:Ash1l UTSW 3 88966234 missense probably damaging 0.99
R5090:Ash1l UTSW 3 89052877 missense probably damaging 1.00
R5113:Ash1l UTSW 3 89066275 missense probably damaging 0.99
R5408:Ash1l UTSW 3 88982394 missense probably damaging 1.00
R5452:Ash1l UTSW 3 88984876 missense possibly damaging 0.93
R5487:Ash1l UTSW 3 88981426 missense probably benign 0.17
R5610:Ash1l UTSW 3 89023185 missense probably damaging 1.00
R5624:Ash1l UTSW 3 88985609 missense probably damaging 1.00
R5682:Ash1l UTSW 3 89007607 missense probably damaging 0.99
R5712:Ash1l UTSW 3 89051990 missense probably damaging 0.99
R5719:Ash1l UTSW 3 89054498 missense possibly damaging 0.83
R5719:Ash1l UTSW 3 89058626 missense probably damaging 1.00
R5839:Ash1l UTSW 3 88983351 missense probably damaging 0.99
R5859:Ash1l UTSW 3 89068993 missense probably damaging 1.00
R5877:Ash1l UTSW 3 88981584 missense probably benign 0.00
R5940:Ash1l UTSW 3 88984036 missense probably damaging 0.96
R6026:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6027:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6029:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6033:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6034:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6035:Ash1l UTSW 3 88985019 missense probably damaging 1.00
R6089:Ash1l UTSW 3 89053143 nonsense probably null
R6110:Ash1l UTSW 3 88985129 missense probably damaging 1.00
R6168:Ash1l UTSW 3 89052773 nonsense probably null
R6200:Ash1l UTSW 3 89070527 missense probably damaging 1.00
R6290:Ash1l UTSW 3 88982761 nonsense probably null
R6331:Ash1l UTSW 3 89007865 missense probably benign 0.00
R6425:Ash1l UTSW 3 88983780 missense probably damaging 0.99
R6540:Ash1l UTSW 3 88985061 missense probably damaging 1.00
R6568:Ash1l UTSW 3 89052037 missense probably benign 0.09
R6828:Ash1l UTSW 3 89076113 missense probably benign 0.00
R6843:Ash1l UTSW 3 88985388 missense probably damaging 1.00
R6894:Ash1l UTSW 3 88982991 missense probably benign 0.00
R6976:Ash1l UTSW 3 88981657 missense possibly damaging 0.77
R7038:Ash1l UTSW 3 88982671 missense probably benign 0.00
R7133:Ash1l UTSW 3 88983457 frame shift probably null
R7150:Ash1l UTSW 3 89077074 missense probably damaging 1.00
R7205:Ash1l UTSW 3 88965952 missense probably benign 0.00
R7254:Ash1l UTSW 3 89070509 missense probably damaging 1.00
R7272:Ash1l UTSW 3 89054634 intron probably null
R7288:Ash1l UTSW 3 88965892 start gained probably benign
R7319:Ash1l UTSW 3 88981387 missense probably benign 0.19
R7341:Ash1l UTSW 3 88981759 missense possibly damaging 0.93
R7342:Ash1l UTSW 3 88965997 missense possibly damaging 0.94
R7454:Ash1l UTSW 3 88983865 missense probably benign 0.16
R7677:Ash1l UTSW 3 89043193 missense probably damaging 1.00
R7822:Ash1l UTSW 3 89007264 missense probably benign
X0017:Ash1l UTSW 3 88984585 missense probably benign 0.45
X0019:Ash1l UTSW 3 89070556 missense probably damaging 1.00
X0021:Ash1l UTSW 3 88983204 missense probably benign 0.10
Z1088:Ash1l UTSW 3 88982709 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTTTCTTACAACCAGCAGGACC -3'
(R):5'- ACTGGGAGAACTTTCTGAGCAG -3'

Sequencing Primer
(F):5'- GGACCCCTCTCCTTTCCATGAG -3'
(R):5'- AGGTGTTTGCAATCCCAAGGC -3'
Posted On2019-05-15