Mutagenetix > Incidental Mutations

Incidental Mutation 'R7073:Lrrc7'

549014

Institutional Source

Beutler Lab

Gene Symbol

Lrrc7

Ensembl Gene

ENSMUSG00000028176

Gene Name

leucine rich repeat containing 7

Synonyms

densin

MMRRC Submission

Accession Numbers

Genbank: NM_001081358; MGI: 2676665

Is this an essential gene?

Possibly essential (E-score: 0.677) question?

Stock #

R7073 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

158082891-158562221 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 158127247 bp

Zygosity

Heterozygous

Amino Acid Change

Glycine to Arginine at position 1425 (G1425R)

Ref Sequence

ENSEMBL: ENSMUSP00000142498 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000106044] [ENSMUST00000199890] [ENSMUST00000200137]

Predicted Effect

probably damaging
Transcript: ENSMUST00000106044
AA Change: G1472R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000101659
Gene: ENSMUSG00000028176
AA Change: G1472R

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1349	1378	2e-11	BLAST
PDZ	1460	1540	1.33e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000199890
AA Change: G1385R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142440
Gene: ENSMUSG00000028176
AA Change: G1385R

Domain	Start	End	E-Value	Type
LRR	53	73	3.65e0	SMART
LRR	96	118	2.2e1	SMART
LRR	142	164	4.21e1	SMART
LRR	165	187	7.36e0	SMART
LRR	188	210	7.05e-1	SMART
LRR	211	233	3.09e1	SMART
LRR	234	257	4.21e1	SMART
LRR	258	279	2.61e2	SMART
LRR	280	303	3.52e-1	SMART
LRR	326	349	1.99e0	SMART
LRR	372	394	2.63e0	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	9e-6	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1328	1364	1e-15	BLAST
low complexity region	1374	1387	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000200137
AA Change: G1425R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000142498
Gene: ENSMUSG00000028176
AA Change: G1425R

Domain	Start	End	E-Value	Type
LRR	52	69	7.6e-1	SMART
LRR	73	92	4.2e-1	SMART
LRR	96	115	3.4e-1	SMART
LRR	142	164	1.8e-1	SMART
LRR	165	184	1.5e-1	SMART
LRR	188	207	2e-2	SMART
LRR	211	233	1.3e-1	SMART
LRR	234	257	1.7e-1	SMART
LRR	257	276	1e0	SMART
LRR	280	299	3.1e-2	SMART
LRR	303	322	6.6e-1	SMART
LRR	326	345	2.1e-1	SMART
LRR	372	391	1.2e-1	SMART
low complexity region	466	476	N/A	INTRINSIC
low complexity region	692	705	N/A	INTRINSIC
Blast:PDZ	708	736	1e-5	BLAST
low complexity region	787	797	N/A	INTRINSIC
low complexity region	864	878	N/A	INTRINSIC
Blast:PDZ	1302	1331	2e-11	BLAST
PDZ	1413	1493	6.4e-22	SMART

Predicted Effect

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit limb grasping, reduced long term depression, increased anxiety, increased aggression towards other mice, impaired spatial memory, decreased prepulse inhibition, decreased nesting building behavior, and abnormal dendritic spines. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	G	13: 81,561,474	E1133D	probably damaging	Het
Ankrd13b	A	T	11: 77,472,509	D505E	probably benign	Het
Ano1	C	T	7: 144,638,552	E361K	probably damaging	Het
Arap3	T	A	18: 37,974,442	K1341*	probably null	Het
Arhgef17	A	C	7: 100,929,991	Y583*	probably null	Het
Ash1l	G	A	3: 88,985,340	E1509K	probably damaging	Het
B430305J03Rik	T	G	3: 61,364,260	R21S	unknown	Het
Bbof1	A	G	12: 84,426,835	E313G	probably damaging	Het
Catsperb	C	T	12: 101,509,238	T347I	probably benign	Het
Ccdc24	G	T	4: 117,872,004	A92D	probably damaging	Het
Ccdc63	T	C	5: 122,111,010	T419A	probably benign	Het
Ccdc7a	C	T	8: 128,892,385	V893I	possibly damaging	Het
Ccdc88b	G	T	19: 6,853,962	D537E	probably benign	Het
Cd276	T	C	9: 58,537,332	S119G	probably damaging	Het
Cdkn3	T	C	14: 46,767,190	Y70H	possibly damaging	Het
Cdo1	G	A	18: 46,728,199		probably benign	Het
Cdr2	A	T	7: 120,982,024	F10Y	probably damaging	Het
Cep290	A	T	10: 100,539,003	K1370N	possibly damaging	Het
Crb1	T	A	1: 139,248,311	I645F	probably damaging	Het
Cul7	T	C	17: 46,658,731	W975R	probably damaging	Het
Ddx39b	A	C	17: 35,252,850	E324A	probably benign	Het
Diaph1	T	G	18: 37,889,814		probably null	Het
Dnah2	G	A	11: 69,430,492	R3917*	probably null	Het
Dnph1	T	A	17: 46,496,889	L27Q	probably damaging	Het
Duox2	A	G	2: 122,289,307	F880S	probably damaging	Het
Ell2	C	A	13: 75,761,887	L119M	probably damaging	Het
Enpep	A	T	3: 129,312,670	Y302*	probably null	Het
Ergic2	G	T	6: 148,195,209	H186Q	probably damaging	Het
Fam83b	T	C	9: 76,545,749	D12G	probably benign	Het
Fbxw16	A	T	9: 109,441,055	V206D	probably damaging	Het
Fhod1	A	T	8: 105,337,139	V278D	unknown	Het
Gba2	G	C	4: 43,573,753	Q180E	probably damaging	Het
Gm11127	A	T	17: 36,058,343	C7S	unknown	Het
Grhl3	G	A	4: 135,573,412	L5F	probably benign	Het
Ifit1bl1	C	T	19: 34,599,267		probably null	Het
Ift57	A	G	16: 49,763,867	T413A	probably benign	Het
Itga2	A	G	13: 114,859,613	F714S	probably damaging	Het
Jmy	A	G	13: 93,441,333	S776P	probably benign	Het
Kbtbd8	G	A	6: 95,121,833	A108T	probably damaging	Het
Kpna6	G	A	4: 129,654,346	A230V	probably damaging	Het
Lrfn1	C	T	7: 28,459,972	L439F	possibly damaging	Het
Lrrc1	T	A	9: 77,468,565	I147F	probably benign	Het
Madd	T	A	2: 91,162,509	I1022F	probably damaging	Het
Map2k2	A	T	10: 81,106,183	T13S	probably benign	Het
Mdc1	G	A	17: 35,854,068	V1459I	probably benign	Het
Mdh1b	G	A	1: 63,721,560	T114M	probably damaging	Het
Mfsd2a	T	C	4: 122,951,295	I208V	possibly damaging	Het
Mmrn1	T	A	6: 60,988,427	D1147E	probably damaging	Het
Nbeal2	T	A	9: 110,626,109	I2574F	probably damaging	Het
Nr1d1	T	G	11: 98,772,066	S34R	probably damaging	Het
Nr3c1	A	T	18: 39,486,396	D279E	probably benign	Het
Nrde2	T	C	12: 100,132,488	D640G	probably benign	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1184	A	T	2: 88,487,307	I192F	probably benign	Het
Olfr1287	A	T	2: 111,449,286	I49F	probably benign	Het
Otud6b	A	C	4: 14,811,743	M300R	probably damaging	Het
Pamr1	T	A	2: 102,640,935	D534E	probably benign	Het
Pcdh7	T	A	5: 57,720,957	V618E	probably benign	Het
Pcgf6	A	C	19: 47,042,787	N266K	possibly damaging	Het
Plcz1	A	T	6: 140,023,123	Y196*	probably null	Het
Plxna1	A	T	6: 89,357,329	L106Q	probably damaging	Het
Qrich2	G	A	11: 116,446,875	A184V	probably damaging	Het
Rimkla	A	G	4: 119,468,078	L378S	probably benign	Het
Rufy1	G	T	11: 50,404,463	H472Q	probably benign	Het
Samd7	T	A	3: 30,756,482	M216K	probably benign	Het
Samd9l	A	T	6: 3,375,856	Y468*	probably null	Het
Scn2a	T	G	2: 65,728,443	L1194R	probably benign	Het
Sgo2a	T	A	1: 58,017,785	S1043T	possibly damaging	Het
Slc6a17	G	T	3: 107,471,439	H642Q	probably benign	Het
Smox	C	T	2: 131,522,111	A45V	possibly damaging	Het
St6galnac3	T	A	3: 153,411,637	T150S	possibly damaging	Het
Strip2	T	A	6: 29,941,912	I627N	possibly damaging	Het
Sv2c	A	T	13: 96,088,250	C184S	probably damaging	Het
Tm7sf2	A	T	19: 6,066,497		probably null	Het
Ttc28	T	C	5: 111,223,416	I608T	possibly damaging	Het
Vmn1r183	T	G	7: 24,055,501	L243R	probably damaging	Het
Vmn1r68	T	C	7: 10,527,851	T107A	probably benign	Het
Vnn3	G	A	10: 23,864,413	G205R	probably damaging	Het
Zfp516	T	A	18: 82,988,200		probably null	Het
Zpbp2	A	G	11: 98,552,509	D56G	probably damaging	Het

Other mutations in Lrrc7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00594:Lrrc7	APN	3	158187010	missense	probably benign	0.07
IGL00644:Lrrc7	APN	3	158202368	nonsense	probably null
IGL00822:Lrrc7	APN	3	158185474	missense	probably damaging	0.99
IGL00927:Lrrc7	APN	3	158161090	missense	possibly damaging	0.94
IGL00946:Lrrc7	APN	3	158161356	missense	probably benign	0.07
IGL00948:Lrrc7	APN	3	158161557	missense	probably damaging	1.00
IGL01838:Lrrc7	APN	3	158185463	missense	probably damaging	1.00
IGL01874:Lrrc7	APN	3	158240443	splice site	probably benign
IGL02514:Lrrc7	APN	3	158160292	missense	probably damaging	0.96
IGL02545:Lrrc7	APN	3	158185374	splice site	probably benign
IGL02665:Lrrc7	APN	3	158161105	missense	probably damaging	0.99
IGL03129:Lrrc7	APN	3	158161059	missense	probably benign	0.02
N/A:Lrrc7	UTSW	3	158160340	missense	probably benign
R0021:Lrrc7	UTSW	3	158160661	missense	probably damaging	1.00
R0041:Lrrc7	UTSW	3	158164260	splice site	probably benign
R0255:Lrrc7	UTSW	3	158160838	nonsense	probably null
R0278:Lrrc7	UTSW	3	158179795	missense	possibly damaging	0.96
R0409:Lrrc7	UTSW	3	158161426	missense	possibly damaging	0.59
R0612:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R0866:Lrrc7	UTSW	3	158164266	splice site	probably benign
R1077:Lrrc7	UTSW	3	158161143	missense	probably damaging	1.00
R1103:Lrrc7	UTSW	3	158148706	splice site	probably benign
R1157:Lrrc7	UTSW	3	158160255	missense	probably damaging	1.00
R1187:Lrrc7	UTSW	3	158160402	missense	probably damaging	1.00
R1301:Lrrc7	UTSW	3	158135331	missense	probably benign	0.20
R1433:Lrrc7	UTSW	3	158177306	missense	probably damaging	1.00
R1450:Lrrc7	UTSW	3	158187044	missense	possibly damaging	0.62
R1595:Lrrc7	UTSW	3	158177277	nonsense	probably null
R1659:Lrrc7	UTSW	3	158161408	missense	probably damaging	1.00
R1693:Lrrc7	UTSW	3	158084533	missense	possibly damaging	0.95
R1774:Lrrc7	UTSW	3	158160292	missense	possibly damaging	0.88
R2273:Lrrc7	UTSW	3	158187059	missense	probably damaging	1.00
R2276:Lrrc7	UTSW	3	158179792	missense	probably damaging	1.00
R2302:Lrrc7	UTSW	3	158135244	missense	probably damaging	0.99
R2326:Lrrc7	UTSW	3	158170661	missense	probably damaging	1.00
R2371:Lrrc7	UTSW	3	158161060	missense	probably damaging	0.99
R2383:Lrrc7	UTSW	3	158163956	missense	probably benign
R2679:Lrrc7	UTSW	3	158175108	nonsense	probably null
R2698:Lrrc7	UTSW	3	158135391	missense	probably benign	0.22
R2858:Lrrc7	UTSW	3	158161725	missense	probably damaging	0.99
R3758:Lrrc7	UTSW	3	158163965	missense	probably damaging	1.00
R3791:Lrrc7	UTSW	3	158163956	missense	probably benign
R3805:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3806:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3807:Lrrc7	UTSW	3	158185493	missense	probably benign	0.10
R3892:Lrrc7	UTSW	3	158160696	missense	probably benign	0.08
R3912:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3913:Lrrc7	UTSW	3	158291952	missense	probably damaging	1.00
R3963:Lrrc7	UTSW	3	158160405	missense	probably damaging	1.00
R4665:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4666:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4671:Lrrc7	UTSW	3	158202495	critical splice acceptor site	probably null
R4688:Lrrc7	UTSW	3	158148605	missense	probably damaging	1.00
R4725:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4726:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4728:Lrrc7	UTSW	3	158318408	critical splice donor site	probably benign
R4783:Lrrc7	UTSW	3	158127213	critical splice donor site	probably null
R4867:Lrrc7	UTSW	3	158161005	missense	probably damaging	1.00
R4907:Lrrc7	UTSW	3	158161240	missense	probably damaging	1.00
R5032:Lrrc7	UTSW	3	158181580	missense	possibly damaging	0.85
R5107:Lrrc7	UTSW	3	158161896	missense	probably damaging	1.00
R5295:Lrrc7	UTSW	3	158170739	missense	probably damaging	1.00
R5348:Lrrc7	UTSW	3	158175326	missense	probably benign	0.02
R5468:Lrrc7	UTSW	3	158318436	missense	probably damaging	1.00
R5778:Lrrc7	UTSW	3	158170743	missense	probably damaging	1.00
R5897:Lrrc7	UTSW	3	158164353	missense	probably damaging	0.98
R6179:Lrrc7	UTSW	3	158353432	missense	probably damaging	0.99
R6312:Lrrc7	UTSW	3	158160609	missense	probably benign	0.04
R6313:Lrrc7	UTSW	3	158160736	missense	probably damaging	1.00
R6366:Lrrc7	UTSW	3	158135375	missense	probably benign	0.04
R6389:Lrrc7	UTSW	3	158185426	missense	probably damaging	1.00
R6638:Lrrc7	UTSW	3	158135303	missense	probably benign	0.20
R6956:Lrrc7	UTSW	3	158289031	missense	probably benign	0.02
R6969:Lrrc7	UTSW	3	158156913	missense	probably benign	0.19
R7313:Lrrc7	UTSW	3	158160474	missense	probably damaging	1.00
R7365:Lrrc7	UTSW	3	158198161	missense	probably damaging	1.00
R7398:Lrrc7	UTSW	3	158291958	nonsense	probably null
R7403:Lrrc7	UTSW	3	158148674	nonsense	probably null
R7407:Lrrc7	UTSW	3	158135241	missense	probably damaging	1.00
R7427:Lrrc7	UTSW	3	158198141	missense	probably benign	0.06
R7453:Lrrc7	UTSW	3	158185409	missense	probably benign	0.00
R7461:Lrrc7	UTSW	3	158187020	missense	probably benign	0.00
R7807:Lrrc7	UTSW	3	158160487	missense	probably damaging	1.00
R7872:Lrrc7	UTSW	3	158353462	missense	probably damaging	0.99
R8215:Lrrc7	UTSW	3	158209750	missense	probably benign
R8367:Lrrc7	UTSW	3	158202370	missense	possibly damaging	0.80

Predicted Primers

PCR Primer
(F):5'- ACAGACTCGTTTCAGCTTCTG -3'
(R):5'- AGGCATAGAGAGACATTACCCC -3'

Sequencing Primer
(F):5'- AGACTCGTTTCAGCTTCTGTCTGG -3'
(R):5'- GTTCTGTGTGAGGATAGAAA -3'

Posted On

2019-05-15