Mutagenetix > Incidental Mutations

Incidental Mutation 'R7073:Samd9l'

549025

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7073 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 3375856 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 468 (Y468*)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

Predicted Effect

probably null
Transcript: ENSMUST00000120087
AA Change: Y468*

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: Y468*

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 80 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrv1	T	G	13: 81,561,474	E1133D	probably damaging	Het
Ankrd13b	A	T	11: 77,472,509	D505E	probably benign	Het
Ano1	C	T	7: 144,638,552	E361K	probably damaging	Het
Arap3	T	A	18: 37,974,442	K1341*	probably null	Het
Arhgef17	A	C	7: 100,929,991	Y583*	probably null	Het
Ash1l	G	A	3: 88,985,340	E1509K	probably damaging	Het
B430305J03Rik	T	G	3: 61,364,260	R21S	unknown	Het
Bbof1	A	G	12: 84,426,835	E313G	probably damaging	Het
Catsperb	C	T	12: 101,509,238	T347I	probably benign	Het
Ccdc24	G	T	4: 117,872,004	A92D	probably damaging	Het
Ccdc63	T	C	5: 122,111,010	T419A	probably benign	Het
Ccdc7a	C	T	8: 128,892,385	V893I	possibly damaging	Het
Ccdc88b	G	T	19: 6,853,962	D537E	probably benign	Het
Cd276	T	C	9: 58,537,332	S119G	probably damaging	Het
Cdkn3	T	C	14: 46,767,190	Y70H	possibly damaging	Het
Cdo1	G	A	18: 46,728,199		probably benign	Het
Cdr2	A	T	7: 120,982,024	F10Y	probably damaging	Het
Cep290	A	T	10: 100,539,003	K1370N	possibly damaging	Het
Crb1	T	A	1: 139,248,311	I645F	probably damaging	Het
Cul7	T	C	17: 46,658,731	W975R	probably damaging	Het
Ddx39b	A	C	17: 35,252,850	E324A	probably benign	Het
Diaph1	T	G	18: 37,889,814		probably null	Het
Dnah2	G	A	11: 69,430,492	R3917*	probably null	Het
Dnph1	T	A	17: 46,496,889	L27Q	probably damaging	Het
Duox2	A	G	2: 122,289,307	F880S	probably damaging	Het
Ell2	C	A	13: 75,761,887	L119M	probably damaging	Het
Enpep	A	T	3: 129,312,670	Y302*	probably null	Het
Ergic2	G	T	6: 148,195,209	H186Q	probably damaging	Het
Fam83b	T	C	9: 76,545,749	D12G	probably benign	Het
Fbxw16	A	T	9: 109,441,055	V206D	probably damaging	Het
Fhod1	A	T	8: 105,337,139	V278D	unknown	Het
Gba2	G	C	4: 43,573,753	Q180E	probably damaging	Het
Gm11127	A	T	17: 36,058,343	C7S	unknown	Het
Grhl3	G	A	4: 135,573,412	L5F	probably benign	Het
Ifit1bl1	C	T	19: 34,599,267		probably null	Het
Ift57	A	G	16: 49,763,867	T413A	probably benign	Het
Itga2	A	G	13: 114,859,613	F714S	probably damaging	Het
Jmy	A	G	13: 93,441,333	S776P	probably benign	Het
Kbtbd8	G	A	6: 95,121,833	A108T	probably damaging	Het
Kpna6	G	A	4: 129,654,346	A230V	probably damaging	Het
Lrfn1	C	T	7: 28,459,972	L439F	possibly damaging	Het
Lrrc1	T	A	9: 77,468,565	I147F	probably benign	Het
Lrrc7	C	T	3: 158,127,247	G1425R	probably damaging	Het
Madd	T	A	2: 91,162,509	I1022F	probably damaging	Het
Map2k2	A	T	10: 81,106,183	T13S	probably benign	Het
Mdc1	G	A	17: 35,854,068	V1459I	probably benign	Het
Mdh1b	G	A	1: 63,721,560	T114M	probably damaging	Het
Mfsd2a	T	C	4: 122,951,295	I208V	possibly damaging	Het
Mmrn1	T	A	6: 60,988,427	D1147E	probably damaging	Het
Nbeal2	T	A	9: 110,626,109	I2574F	probably damaging	Het
Nr1d1	T	G	11: 98,772,066	S34R	probably damaging	Het
Nr3c1	A	T	18: 39,486,396	D279E	probably benign	Het
Nrde2	T	C	12: 100,132,488	D640G	probably benign	Het
Odf4	A	G	11: 68,926,688	L58P	probably damaging	Het
Olfr1184	A	T	2: 88,487,307	I192F	probably benign	Het
Olfr1287	A	T	2: 111,449,286	I49F	probably benign	Het
Otud6b	A	C	4: 14,811,743	M300R	probably damaging	Het
Pamr1	T	A	2: 102,640,935	D534E	probably benign	Het
Pcdh7	T	A	5: 57,720,957	V618E	probably benign	Het
Pcgf6	A	C	19: 47,042,787	N266K	possibly damaging	Het
Plcz1	A	T	6: 140,023,123	Y196*	probably null	Het
Plxna1	A	T	6: 89,357,329	L106Q	probably damaging	Het
Qrich2	G	A	11: 116,446,875	A184V	probably damaging	Het
Rimkla	A	G	4: 119,468,078	L378S	probably benign	Het
Rufy1	G	T	11: 50,404,463	H472Q	probably benign	Het
Samd7	T	A	3: 30,756,482	M216K	probably benign	Het
Scn2a	T	G	2: 65,728,443	L1194R	probably benign	Het
Sgo2a	T	A	1: 58,017,785	S1043T	possibly damaging	Het
Slc6a17	G	T	3: 107,471,439	H642Q	probably benign	Het
Smox	C	T	2: 131,522,111	A45V	possibly damaging	Het
St6galnac3	T	A	3: 153,411,637	T150S	possibly damaging	Het
Strip2	T	A	6: 29,941,912	I627N	possibly damaging	Het
Sv2c	A	T	13: 96,088,250	C184S	probably damaging	Het
Tm7sf2	A	T	19: 6,066,497		probably null	Het
Ttc28	T	C	5: 111,223,416	I608T	possibly damaging	Het
Vmn1r183	T	G	7: 24,055,501	L243R	probably damaging	Het
Vmn1r68	T	C	7: 10,527,851	T107A	probably benign	Het
Vnn3	G	A	10: 23,864,413	G205R	probably damaging	Het
Zfp516	T	A	18: 82,988,200		probably null	Het
Zpbp2	A	G	11: 98,552,509	D56G	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	1.00
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6298:Samd9l	UTSW	6	3375383	missense	probably damaging	1.00
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGTCTGTGAGGAATGAAATAAGTC -3'
(R):5'- ACAGCGTCTAGAAAAGCGGC -3'

Sequencing Primer
(F):5'- GGAATGAAATAAGTCTTCTAACCCC -3'
(R):5'- TGTCTAAACTTTTGACCAGACACC -3'

Posted On

2019-05-15