Incidental Mutation 'R0613:Kcnh4'
ID54903
Institutional Source Beutler Lab
Gene Symbol Kcnh4
Ensembl Gene ENSMUSG00000035355
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 4
SynonymsBEC2
MMRRC Submission 038802-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0613 (G1)
Quality Score210
Status Validated
Chromosome11
Chromosomal Location100740376-100759942 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 100746932 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Glutamic Acid at position 633 (G633E)
Ref Sequence ENSEMBL: ENSMUSP00000102986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107361] [ENSMUST00000107363]
Predicted Effect probably benign
Transcript: ENSMUST00000107361
AA Change: G633E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102984
Gene: ENSMUSG00000035355
AA Change: G633E

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
Pfam:Ion_trans 226 486 1.5e-32 PFAM
Pfam:Ion_trans_2 412 480 2.3e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107363
AA Change: G633E

PolyPhen 2 Score 0.194 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000102986
Gene: ENSMUSG00000035355
AA Change: G633E

DomainStartEndE-ValueType
PAS 16 88 1.41e-1 SMART
PAC 94 136 4.88e-5 SMART
low complexity region 155 168 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Pfam:Ion_trans 265 474 1.1e-17 PFAM
Pfam:Ion_trans_2 412 480 2.2e-12 PFAM
cNMP 556 681 1.27e-12 SMART
low complexity region 726 735 N/A INTRINSIC
low complexity region 766 787 N/A INTRINSIC
coiled coil region 874 911 N/A INTRINSIC
low complexity region 981 1006 N/A INTRINSIC
Meta Mutation Damage Score 0.1391 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. The gene is brain-specific, and located in the neocortex and the striatum. It may be involved in cellular excitability of restricted neurons in the central nervous system. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acd A T 8: 105,700,568 probably null Het
Adcy9 A G 16: 4,419,539 S3P probably damaging Het
Adgrl4 T C 3: 151,543,222 probably benign Het
Aff3 T C 1: 38,209,923 E700G probably benign Het
Ahctf1 A G 1: 179,769,414 S56P probably damaging Het
Atp12a T A 14: 56,374,521 I384N probably damaging Het
Brca1 A T 11: 101,508,210 S1519T probably benign Het
Ccl25 T C 8: 4,349,850 V94A probably benign Het
Cep170 T C 1: 176,774,680 T287A probably benign Het
Ces1a A G 8: 93,025,581 S383P probably benign Het
Cntnap3 A T 13: 64,758,414 F793I probably damaging Het
Ctsm T C 13: 61,539,682 R89G probably damaging Het
Cyp2j12 T G 4: 96,102,079 T417P probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Edn2 T A 4: 120,161,864 probably null Het
Emc1 T A 4: 139,375,072 probably benign Het
Fam189a2 T A 19: 23,986,489 N239Y probably damaging Het
Fras1 T C 5: 96,700,488 probably benign Het
Fsip2 A T 2: 82,993,795 D6624V probably damaging Het
Gpr107 A G 2: 31,178,285 Y253C probably damaging Het
Gpr108 A G 17: 57,238,174 probably benign Het
Grik1 A G 16: 88,051,333 probably null Het
Gtf3c1 G A 7: 125,644,134 P1766L possibly damaging Het
Gucy2c A T 6: 136,760,723 N293K probably damaging Het
Hps6 C A 19: 46,003,821 P66T probably benign Het
Hspa9 A T 18: 34,947,980 V216E probably damaging Het
Igsf8 T A 1: 172,317,589 M224K probably benign Het
Igsf9b T C 9: 27,326,920 V569A probably damaging Het
Itgb4 A T 11: 115,993,342 I952F probably damaging Het
Khdrbs2 A G 1: 32,657,522 H344R possibly damaging Het
Kmo C A 1: 175,637,892 R71S probably damaging Het
Lrrc31 A G 3: 30,685,035 probably benign Het
Map1b T A 13: 99,441,641 D168V probably damaging Het
Mfsd6 T C 1: 52,658,696 probably benign Het
Mgst1 G A 6: 138,156,245 G186D probably damaging Het
Mrc1 C T 2: 14,294,819 A740V probably damaging Het
Mroh2a G A 1: 88,243,950 R770Q probably damaging Het
Mtor T C 4: 148,526,046 Y1605H possibly damaging Het
Ncoa4 T A 14: 32,176,552 L443Q probably damaging Het
Nelfa G A 5: 33,903,463 probably benign Het
Nepn T A 10: 52,401,257 L363Q probably damaging Het
Nfat5 A G 8: 107,366,295 T630A possibly damaging Het
Nipal4 A T 11: 46,150,384 V328E probably benign Het
Olfr1228 A T 2: 89,249,125 C178S probably damaging Het
Olfr1391 T A 11: 49,327,748 S112R possibly damaging Het
Olfr462 A T 11: 87,889,227 V223E possibly damaging Het
Olfr747 T A 14: 50,681,404 I77F probably benign Het
Olfr809 T A 10: 129,776,262 M116K probably damaging Het
Olfr924 T A 9: 38,848,613 C166* probably null Het
Otogl A T 10: 107,817,070 N1140K probably damaging Het
Ppip5k2 A C 1: 97,752,740 Y236* probably null Het
Prelid1 C T 13: 55,324,343 R111* probably null Het
Prpf8 T C 11: 75,503,444 L1771P probably damaging Het
Ptprb A T 10: 116,302,325 Y378F possibly damaging Het
Ptprb A G 10: 116,302,378 T396A possibly damaging Het
Rab3il1 T C 19: 10,028,364 L174P probably damaging Het
Rab4a T C 8: 123,823,835 V18A possibly damaging Het
Scn3a T A 2: 65,472,284 M1273L possibly damaging Het
Sdhc A T 1: 171,129,844 V156E probably benign Het
Slco3a1 T C 7: 74,346,634 probably benign Het
Syne3 T C 12: 104,958,112 T343A probably benign Het
Syt11 A G 3: 88,762,469 C39R probably damaging Het
Tll2 G T 19: 41,104,990 D462E probably damaging Het
Tmem132e T A 11: 82,438,338 V481D probably damaging Het
Tmem161b C T 13: 84,251,320 L17F probably damaging Het
Vmn2r105 T A 17: 20,208,316 I833F probably damaging Het
Vstm2a A T 11: 16,263,140 N175I probably damaging Het
Xpnpep1 G T 19: 53,006,353 D238E probably damaging Het
Zfp112 G A 7: 24,127,028 G807D probably benign Het
Zfp518b A T 5: 38,673,603 V353E probably damaging Het
Zfp69 T C 4: 120,934,347 E39G probably benign Het
Zfp865 A G 7: 5,029,091 H25R possibly damaging Het
Other mutations in Kcnh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Kcnh4 APN 11 100756995 splice site probably benign
IGL00430:Kcnh4 APN 11 100757654 missense possibly damaging 0.85
IGL02031:Kcnh4 APN 11 100745823 missense probably damaging 1.00
IGL02346:Kcnh4 APN 11 100756942 missense possibly damaging 0.46
IGL02674:Kcnh4 APN 11 100746894 missense possibly damaging 0.58
IGL02903:Kcnh4 APN 11 100757654 missense possibly damaging 0.50
IGL03152:Kcnh4 APN 11 100745772 missense probably benign 0.00
R0032:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0033:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0066:Kcnh4 UTSW 11 100757800 missense probably benign 0.11
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0242:Kcnh4 UTSW 11 100755699 missense probably damaging 1.00
R0244:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0310:Kcnh4 UTSW 11 100746169 missense probably benign 0.04
R0330:Kcnh4 UTSW 11 100757743 missense probably damaging 1.00
R0345:Kcnh4 UTSW 11 100757681 missense probably benign 0.08
R0436:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0466:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0468:Kcnh4 UTSW 11 100746932 missense probably benign 0.19
R0487:Kcnh4 UTSW 11 100750258 missense probably damaging 0.99
R0562:Kcnh4 UTSW 11 100750244 missense possibly damaging 0.80
R1077:Kcnh4 UTSW 11 100752338 missense possibly damaging 0.72
R1705:Kcnh4 UTSW 11 100741772 missense probably benign
R1840:Kcnh4 UTSW 11 100745341 missense possibly damaging 0.46
R2114:Kcnh4 UTSW 11 100759595 missense probably damaging 1.00
R4448:Kcnh4 UTSW 11 100755907 missense probably benign 0.00
R4823:Kcnh4 UTSW 11 100755174 missense probably damaging 1.00
R4865:Kcnh4 UTSW 11 100749743 missense probably damaging 1.00
R4963:Kcnh4 UTSW 11 100752253 missense probably damaging 1.00
R4977:Kcnh4 UTSW 11 100746833 missense probably damaging 1.00
R5228:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5385:Kcnh4 UTSW 11 100752250 missense probably damaging 1.00
R5414:Kcnh4 UTSW 11 100746896 missense probably damaging 1.00
R5682:Kcnh4 UTSW 11 100749802 missense possibly damaging 0.82
R5945:Kcnh4 UTSW 11 100745322 missense probably damaging 1.00
R6434:Kcnh4 UTSW 11 100750279 missense probably damaging 0.97
R6505:Kcnh4 UTSW 11 100757085 missense probably benign 0.39
R7263:Kcnh4 UTSW 11 100741817 missense probably benign 0.06
R7270:Kcnh4 UTSW 11 100747646 missense probably benign
R7353:Kcnh4 UTSW 11 100757199 missense probably benign 0.18
R7355:Kcnh4 UTSW 11 100752443 missense possibly damaging 0.92
R7544:Kcnh4 UTSW 11 100757080 missense probably benign 0.25
R7563:Kcnh4 UTSW 11 100741854 missense probably benign 0.00
R7664:Kcnh4 UTSW 11 100750322 missense probably damaging 1.00
R7972:Kcnh4 UTSW 11 100752452 missense probably damaging 0.98
R8146:Kcnh4 UTSW 11 100755279 missense probably damaging 1.00
R8166:Kcnh4 UTSW 11 100741886 missense probably benign
R8234:Kcnh4 UTSW 11 100752267 missense possibly damaging 0.83
R8295:Kcnh4 UTSW 11 100749697 missense probably benign 0.17
R8318:Kcnh4 UTSW 11 100752328 missense probably damaging 1.00
R8347:Kcnh4 UTSW 11 100757749 missense probably damaging 1.00
R8413:Kcnh4 UTSW 11 100749793 missense possibly damaging 0.60
R8464:Kcnh4 UTSW 11 100757184 missense probably damaging 1.00
X0025:Kcnh4 UTSW 11 100750243 missense possibly damaging 0.91
X0061:Kcnh4 UTSW 11 100756907 missense probably benign 0.24
Predicted Primers PCR Primer
(F):5'- AGAACCTTGGCGCAGGTTGAAG -3'
(R):5'- AGTGGCTGTCATTCACTCCAACG -3'

Sequencing Primer
(F):5'- CAGGTTGAAGGTTAGGTCCC -3'
(R):5'- GCACTATAGACATCTTCCACTGG -3'
Posted On2013-07-11