Incidental Mutation 'R7073:Ano1'
ID549037
Institutional Source Beutler Lab
Gene Symbol Ano1
Ensembl Gene ENSMUSG00000031075
Gene Nameanoctamin 1, calcium activated chloride channel
SynonymsTmem16a
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location144588549-144751974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 144638552 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 361 (E361K)
Ref Sequence ENSEMBL: ENSMUSP00000112616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033393] [ENSMUST00000118556] [ENSMUST00000121758]
Predicted Effect probably damaging
Transcript: ENSMUST00000033393
AA Change: E304K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033393
Gene: ENSMUSG00000031075
AA Change: E304K

DomainStartEndE-ValueType
low complexity region 129 147 N/A INTRINSIC
Pfam:Anoctamin 320 898 1.3e-149 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118556
AA Change: E362K

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113899
Gene: ENSMUSG00000031075
AA Change: E362K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 112 375 5.5e-83 PFAM
Pfam:Anoctamin 378 955 6.7e-140 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000121758
AA Change: E361K

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000112616
Gene: ENSMUSG00000031075
AA Change: E361K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 54 317 7.1e-83 PFAM
Pfam:Anoctamin 320 901 2.2e-139 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152531
AA Change: E191K

PolyPhen 2 Score 0.659 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000119653
Gene: ENSMUSG00000031075
AA Change: E191K

DomainStartEndE-ValueType
Pfam:Anoct_dimer 2 205 4.4e-64 PFAM
Pfam:Anoctamin 208 335 3e-36 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knockout allele exhibit postnatal death associated with aerophagia, slow postnatal weight gain, cyanosis, and abnormal tracheal morphology. Mice homozygous for a different knock-out allele exhibit proteinuria and intracellular endosomal vesicles in PTE cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Ano1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Ano1 APN 7 144638513 missense probably damaging 1.00
IGL00754:Ano1 APN 7 144597231 missense probably damaging 0.98
IGL00780:Ano1 APN 7 144655630 missense probably damaging 0.99
IGL00918:Ano1 APN 7 144644752 splice site probably benign
IGL01112:Ano1 APN 7 144637145 missense possibly damaging 0.52
IGL01285:Ano1 APN 7 144644742 missense probably benign 0.00
IGL01285:Ano1 APN 7 144595538 missense probably damaging 0.98
IGL01308:Ano1 APN 7 144595498 missense probably damaging 0.99
IGL01407:Ano1 APN 7 144637111 missense probably benign 0.22
IGL01672:Ano1 APN 7 144655675 missense probably damaging 0.96
IGL01920:Ano1 APN 7 144611454 splice site probably benign
IGL01926:Ano1 APN 7 144610875 missense possibly damaging 0.94
IGL02164:Ano1 APN 7 144637181 missense possibly damaging 0.91
IGL02190:Ano1 APN 7 144618883 missense probably benign 0.41
IGL02214:Ano1 APN 7 144655708 missense possibly damaging 0.80
IGL02299:Ano1 APN 7 144590075 missense possibly damaging 0.80
IGL02567:Ano1 APN 7 144611625 missense probably damaging 1.00
IGL03131:Ano1 APN 7 144603585 missense possibly damaging 0.90
IGL03291:Ano1 APN 7 144621675 missense probably damaging 1.00
IGL03299:Ano1 APN 7 144654256 missense probably damaging 1.00
IGL03394:Ano1 APN 7 144595439 splice site probably null
PIT4434001:Ano1 UTSW 7 144610895 missense probably benign 0.28
R0502:Ano1 UTSW 7 144597215 missense probably damaging 1.00
R0595:Ano1 UTSW 7 144590153 missense possibly damaging 0.94
R0732:Ano1 UTSW 7 144619488 critical splice acceptor site probably null
R0970:Ano1 UTSW 7 144595571 missense probably benign 0.02
R0988:Ano1 UTSW 7 144633653 missense possibly damaging 0.94
R1074:Ano1 UTSW 7 144611680 missense probably damaging 0.98
R1301:Ano1 UTSW 7 144633689 missense possibly damaging 0.60
R1528:Ano1 UTSW 7 144595566 missense probably damaging 1.00
R2018:Ano1 UTSW 7 144654250 missense probably damaging 1.00
R2056:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2057:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2058:Ano1 UTSW 7 144648052 missense probably damaging 1.00
R2059:Ano1 UTSW 7 144611390 missense probably damaging 1.00
R2860:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R2861:Ano1 UTSW 7 144590012 missense probably damaging 1.00
R3770:Ano1 UTSW 7 144595569 missense probably damaging 1.00
R3970:Ano1 UTSW 7 144607963 missense probably benign 0.00
R4179:Ano1 UTSW 7 144650505 missense probably damaging 1.00
R4489:Ano1 UTSW 7 144611742 missense probably benign 0.00
R4678:Ano1 UTSW 7 144669552 missense probably benign 0.01
R4915:Ano1 UTSW 7 144611375 missense possibly damaging 0.69
R5114:Ano1 UTSW 7 144657083 missense possibly damaging 0.71
R5362:Ano1 UTSW 7 144648600 unclassified probably benign
R5364:Ano1 UTSW 7 144637204 missense probably damaging 1.00
R5366:Ano1 UTSW 7 144654209 missense possibly damaging 0.85
R5387:Ano1 UTSW 7 144648619 missense probably benign
R5762:Ano1 UTSW 7 144648037 missense probably damaging 0.99
R5857:Ano1 UTSW 7 144637103 missense probably benign 0.02
R6091:Ano1 UTSW 7 144669434 missense probably benign 0.12
R6093:Ano1 UTSW 7 144611377 missense possibly damaging 0.72
R6177:Ano1 UTSW 7 144678741 missense possibly damaging 0.79
R6246:Ano1 UTSW 7 144633725 missense possibly damaging 0.82
R6274:Ano1 UTSW 7 144618863 missense probably benign 0.01
R6323:Ano1 UTSW 7 144611686 missense possibly damaging 0.95
R6574:Ano1 UTSW 7 144607916 critical splice donor site probably null
R6782:Ano1 UTSW 7 144621687 missense probably damaging 1.00
R6880:Ano1 UTSW 7 144644742 missense probably benign 0.00
R6909:Ano1 UTSW 7 144655731 missense probably damaging 0.96
R7066:Ano1 UTSW 7 144637086 missense probably benign 0.35
R7146:Ano1 UTSW 7 144655656 missense probably benign 0.00
R7420:Ano1 UTSW 7 144655641 missense probably benign 0.00
R7874:Ano1 UTSW 7 144621724 missense probably damaging 1.00
R7957:Ano1 UTSW 7 144621724 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATAGCCTCTGAATTCAAGCAGG -3'
(R):5'- TGGCAGCTCCACAATAACAG -3'

Sequencing Primer
(F):5'- TCTGAATTCAAGCAGGTTCCCAGG -3'
(R):5'- CAGATAGCTGTTCTGGGATTCG -3'
Posted On2019-05-15