Incidental Mutation 'R7073:Cdkn3'
ID549063
Institutional Source Beutler Lab
Gene Symbol Cdkn3
Ensembl Gene ENSMUSG00000037628
Gene Namecyclin-dependent kinase inhibitor 3
Synonyms2410006H10Rik, KAP
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_028222.1; MGI:1919641

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location46760541-46771669 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46767190 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 70 (Y70H)
Ref Sequence ENSEMBL: ENSMUSP00000070575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067426] [ENSMUST00000227149] [ENSMUST00000228106]
Predicted Effect possibly damaging
Transcript: ENSMUST00000067426
AA Change: Y70H

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000070575
Gene: ENSMUSG00000037628
AA Change: Y70H

DomainStartEndE-ValueType
PTPc_DSPc 7 197 2.8e-3 SMART
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227149
AA Change: Y70H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Predicted Effect probably benign
Transcript: ENSMUST00000228106
AA Change: Y70H

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dual specificity protein phosphatase family. It was identified as a cyclin-dependent kinase inhibitor, and has been shown to interact with, and dephosphorylate CDK2 kinase, thus prevent the activation of CDK2 kinase. This gene was reported to be deleted, mutated, or overexpressed in several kinds of cancers. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Cdkn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
E0374:Cdkn3 UTSW 14 46767173 splice site probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0033:Cdkn3 UTSW 14 46768872 nonsense probably null
R0445:Cdkn3 UTSW 14 46767400 critical splice donor site probably null
R1912:Cdkn3 UTSW 14 46769834 critical splice acceptor site probably null
R3176:Cdkn3 UTSW 14 46771477 unclassified probably benign
R3276:Cdkn3 UTSW 14 46771477 unclassified probably benign
R4941:Cdkn3 UTSW 14 46769863 missense possibly damaging 0.90
R5344:Cdkn3 UTSW 14 46767350 missense possibly damaging 0.94
R5964:Cdkn3 UTSW 14 46767217 missense probably null 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R6039:Cdkn3 UTSW 14 46769916 missense probably damaging 1.00
R7234:Cdkn3 UTSW 14 46771461 missense unknown
Predicted Primers PCR Primer
(F):5'- AGTTCTAATCAGCTTTTGTTCCAGG -3'
(R):5'- AACGTACTGTATCAGGGTTTTCCG -3'

Sequencing Primer
(F):5'- AATCAGCTTTTGTTCCAGGTATTTTC -3'
(R):5'- CCGGTTGTTTTTGAGGCAG -3'
Posted On2019-05-15