Incidental Mutation 'R7073:Cul7'
ID549069
Institutional Source Beutler Lab
Gene Symbol Cul7
Ensembl Gene ENSMUSG00000038545
Gene Namecullin 7
Synonymsp185, 2510004L20Rik, C230011P08Rik, p193
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location46650337-46664364 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46658731 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 975 (W975R)
Ref Sequence ENSEMBL: ENSMUSP00000049128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043464] [ENSMUST00000133393] [ENSMUST00000145567]
Predicted Effect probably damaging
Transcript: ENSMUST00000043464
AA Change: W975R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000049128
Gene: ENSMUSG00000038545
AA Change: W975R

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
low complexity region 218 229 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 423 5.7e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
low complexity region 603 618 N/A INTRINSIC
low complexity region 635 648 N/A INTRINSIC
APC10 811 973 9.35e-49 SMART
low complexity region 983 993 N/A INTRINSIC
low complexity region 1063 1074 N/A INTRINSIC
low complexity region 1301 1318 N/A INTRINSIC
low complexity region 1335 1370 N/A INTRINSIC
Blast:Cullin_Nedd8 1550 1633 1e-41 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000133393
SMART Domains Protein: ENSMUSP00000119393
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 17 26 N/A INTRINSIC
Pfam:Cul7 51 126 8e-34 PFAM
low complexity region 164 178 N/A INTRINSIC
low complexity region 305 320 N/A INTRINSIC
low complexity region 337 350 N/A INTRINSIC
SCOP:d1gqpa_ 487 568 1e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145567
SMART Domains Protein: ENSMUSP00000116133
Gene: ENSMUSG00000038545

DomainStartEndE-ValueType
low complexity region 46 54 N/A INTRINSIC
SCOP:d1jdha_ 63 222 2e-4 SMART
low complexity region 315 324 N/A INTRINSIC
Pfam:Cul7 349 424 9.5e-34 PFAM
low complexity region 462 476 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of an E3 ubiquitin-protein ligase complex. The encoded protein interacts with TP53, CUL9, and FBXW8 proteins. Defects in this gene are a cause of 3M syndrome type 1 (3M1). Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
PHENOTYPE: During late gestation, homozygous null fetuses display reduced growth associated with abnormal placental development and hemorrhaging due to vascular defects. Mutant mice are born but die shortly after birth, succumbing to respiratory distress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Cul7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Cul7 APN 17 46652508 missense probably damaging 1.00
IGL01288:Cul7 APN 17 46657807 splice site probably benign
IGL01669:Cul7 APN 17 46658715 missense possibly damaging 0.94
P0019:Cul7 UTSW 17 46660247 splice site probably benign
PIT4453001:Cul7 UTSW 17 46651820 missense probably damaging 0.99
R0083:Cul7 UTSW 17 46655556 missense probably benign 0.00
R0121:Cul7 UTSW 17 46663373 missense probably damaging 1.00
R0157:Cul7 UTSW 17 46653835 missense possibly damaging 0.93
R0266:Cul7 UTSW 17 46654595 missense probably benign 0.00
R0358:Cul7 UTSW 17 46663744 critical splice donor site probably null
R0544:Cul7 UTSW 17 46663544 missense possibly damaging 0.94
R0565:Cul7 UTSW 17 46652003 missense probably damaging 0.98
R0677:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0696:Cul7 UTSW 17 46659608 missense probably damaging 1.00
R0702:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0735:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0893:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0900:Cul7 UTSW 17 46658337 missense probably benign 0.36
R0975:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R0976:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1014:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1016:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1104:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1162:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1378:Cul7 UTSW 17 46662126 missense probably damaging 0.99
R1479:Cul7 UTSW 17 46651747 missense probably damaging 1.00
R1498:Cul7 UTSW 17 46655710 missense probably benign 0.01
R1521:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1542:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1545:Cul7 UTSW 17 46651553 missense probably damaging 1.00
R1598:Cul7 UTSW 17 46663091 missense probably benign 0.10
R1600:Cul7 UTSW 17 46651822 nonsense probably null
R1618:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R1752:Cul7 UTSW 17 46653167 missense probably benign 0.10
R1881:Cul7 UTSW 17 46651962 missense probably damaging 1.00
R1901:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1902:Cul7 UTSW 17 46655740 missense probably damaging 1.00
R1913:Cul7 UTSW 17 46663190 missense probably damaging 0.99
R2213:Cul7 UTSW 17 46651472 missense probably damaging 0.99
R2370:Cul7 UTSW 17 46661641 missense probably damaging 1.00
R2929:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2930:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2990:Cul7 UTSW 17 46651600 missense probably benign 0.00
R2992:Cul7 UTSW 17 46651600 missense probably benign 0.00
R4201:Cul7 UTSW 17 46661312 missense probably damaging 1.00
R4792:Cul7 UTSW 17 46657050 nonsense probably null
R4971:Cul7 UTSW 17 46659119 missense probably benign 0.00
R5014:Cul7 UTSW 17 46655942 makesense probably null
R5384:Cul7 UTSW 17 46654477 missense probably benign 0.44
R5957:Cul7 UTSW 17 46657757 missense probably damaging 1.00
R6128:Cul7 UTSW 17 46651662 missense probably damaging 1.00
R6294:Cul7 UTSW 17 46663148 missense probably benign
R6812:Cul7 UTSW 17 46661409 missense probably benign 0.00
R7112:Cul7 UTSW 17 46651698 missense probably damaging 1.00
R7246:Cul7 UTSW 17 46662067 missense probably benign 0.04
R7361:Cul7 UTSW 17 46657007 missense probably damaging 1.00
R7567:Cul7 UTSW 17 46654595 missense probably benign 0.00
R7682:Cul7 UTSW 17 46655595 missense probably benign
R7689:Cul7 UTSW 17 46652821 nonsense probably null
R7797:Cul7 UTSW 17 46658642 missense possibly damaging 0.65
R7897:Cul7 UTSW 17 46658005 missense probably benign
R7980:Cul7 UTSW 17 46658005 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTTTAGATTTTGAGCCGG -3'
(R):5'- GAAGGCTTTGACCTTCCCCAAG -3'

Sequencing Primer
(F):5'- GCTGGTTTAAAGGGCAAAGC -3'
(R):5'- TGACCTTCCCCAAGCCCTAG -3'
Posted On2019-05-15