Incidental Mutation 'R7073:Diaph1'
ID549070
Institutional Source Beutler Lab
Gene Symbol Diaph1
Ensembl Gene ENSMUSG00000024456
Gene Namediaphanous related formin 1
SynonymsDrf1, Dia1, D18Wsu154e, mDia1, Diap1, p140mDia
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location37843601-37935476 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to G at 37889814 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000078942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025337] [ENSMUST00000080033] [ENSMUST00000115629] [ENSMUST00000115631] [ENSMUST00000115634]
Predicted Effect probably null
Transcript: ENSMUST00000025337
SMART Domains Protein: ENSMUSP00000025337
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 84 268 1.07e-57 SMART
Drf_FH3 274 466 2.06e-68 SMART
coiled coil region 471 571 N/A INTRINSIC
Pfam:Drf_FH1 609 756 6.1e-43 PFAM
FH2 761 1206 2.46e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000080033
SMART Domains Protein: ENSMUSP00000078942
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 7.9e-52 PFAM
FH2 752 1197 3.73e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115629
SMART Domains Protein: ENSMUSP00000111292
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 7.6e-52 PFAM
FH2 717 1162 3.73e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115631
SMART Domains Protein: ENSMUSP00000111294
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
Drf_GBD 40 224 1.07e-57 SMART
Drf_FH3 230 422 2.06e-68 SMART
coiled coil region 427 527 N/A INTRINSIC
Pfam:Drf_FH1 554 712 1.1e-51 PFAM
FH2 717 1162 2.46e-182 SMART
Predicted Effect probably null
Transcript: ENSMUST00000115634
SMART Domains Protein: ENSMUSP00000111297
Gene: ENSMUSG00000024456

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Drf_GBD 75 259 1.07e-57 SMART
Drf_FH3 265 457 2.06e-68 SMART
coiled coil region 462 562 N/A INTRINSIC
Pfam:Drf_FH1 589 747 9.4e-52 PFAM
FH2 752 1197 2.46e-182 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the formin family of proteins that play important roles in cytoskeletal rearragnement by nucleation of actin filaments. Mice lacking the encoded protein develop age-dependent myeloproliferative defects resembling human myeloproliferative syndrome and myelodysplastic syndromes. Trafficking of T lymphocytes to secondary lymphoid organs and egression of thymocytes from the thymus are impaired in these animals. Lack of the encoded protein in T lymphocytes and thymocytes also reduces chemotaxis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal hematopoiesis, bone marrow cell morphology, spleen morphology, skin physiology, skull morphology, and postnatal growth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nr3c1 A T 18: 39,486,396 D279E probably benign Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Diaph1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Diaph1 APN 18 37893348 critical splice donor site probably null
IGL01432:Diaph1 APN 18 37897504 missense unknown
IGL01646:Diaph1 APN 18 37893416 critical splice acceptor site probably null
IGL01676:Diaph1 APN 18 37856188 nonsense probably null
IGL01731:Diaph1 APN 18 37853709 critical splice acceptor site probably benign
IGL01921:Diaph1 APN 18 37856208 missense possibly damaging 0.73
IGL02200:Diaph1 APN 18 37890682 missense unknown
IGL02258:Diaph1 APN 18 37853330 missense probably damaging 0.99
IGL02325:Diaph1 APN 18 37853600 missense probably damaging 1.00
IGL03304:Diaph1 APN 18 37854573 missense possibly damaging 0.47
albatross UTSW 18 37853679 nonsense probably null
cucamonga UTSW 18 37896093 critical splice donor site probably null
damselfly UTSW 18 37897550 nonsense probably null
devastator UTSW 18 37896093 critical splice donor site probably null
Guangzhou UTSW 18 37896093 critical splice donor site probably null
seethrough UTSW 18 37889769 missense probably damaging 1.00
sheer UTSW 18 37896093 critical splice donor site probably benign
R0137:Diaph1 UTSW 18 37891849 missense unknown
R0446:Diaph1 UTSW 18 37853590 missense possibly damaging 0.94
R0523:Diaph1 UTSW 18 37856500 missense possibly damaging 0.56
R1433:Diaph1 UTSW 18 37905134 missense unknown
R1532:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1534:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1535:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1536:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1537:Diaph1 UTSW 18 37896093 critical splice donor site probably null
R1611:Diaph1 UTSW 18 37900702 missense unknown
R1756:Diaph1 UTSW 18 37854573 missense possibly damaging 0.47
R1771:Diaph1 UTSW 18 37891018 missense unknown
R1812:Diaph1 UTSW 18 37891018 missense unknown
R2121:Diaph1 UTSW 18 37896389 missense unknown
R3710:Diaph1 UTSW 18 37845484 missense probably damaging 1.00
R3891:Diaph1 UTSW 18 37900638 splice site probably benign
R3892:Diaph1 UTSW 18 37900638 splice site probably benign
R4077:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4079:Diaph1 UTSW 18 37853583 missense possibly damaging 0.68
R4771:Diaph1 UTSW 18 37853551 missense probably damaging 1.00
R4815:Diaph1 UTSW 18 37895203 missense unknown
R5242:Diaph1 UTSW 18 37851635 missense probably damaging 1.00
R5294:Diaph1 UTSW 18 37897550 nonsense probably null
R5294:Diaph1 UTSW 18 37897580 missense unknown
R5349:Diaph1 UTSW 18 37891072 missense unknown
R5427:Diaph1 UTSW 18 37890595 missense unknown
R5623:Diaph1 UTSW 18 37896093 critical splice donor site probably benign
R5677:Diaph1 UTSW 18 37855951 missense probably damaging 1.00
R5730:Diaph1 UTSW 18 37903776 missense unknown
R5767:Diaph1 UTSW 18 37853355 missense probably damaging 1.00
R5925:Diaph1 UTSW 18 37891935 missense unknown
R6151:Diaph1 UTSW 18 37853353 missense probably damaging 1.00
R6823:Diaph1 UTSW 18 37876383 intron probably null
R6876:Diaph1 UTSW 18 37896373 missense unknown
R6925:Diaph1 UTSW 18 37853679 nonsense probably null
R6983:Diaph1 UTSW 18 37889769 missense probably damaging 1.00
R7248:Diaph1 UTSW 18 37889776 missense probably benign 0.26
R7400:Diaph1 UTSW 18 37854502 missense probably damaging 1.00
R7497:Diaph1 UTSW 18 37895300 critical splice acceptor site probably null
R7544:Diaph1 UTSW 18 37893269 intron probably null
R7703:Diaph1 UTSW 18 37890809 missense unknown
R7834:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
R7917:Diaph1 UTSW 18 37853709 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- AAGGGACATGGTAAGCTCTCC -3'
(R):5'- TCTGAAACCAGGAGATTTGGGG -3'

Sequencing Primer
(F):5'- ATGGTAAGCTCTCCATGTCTG -3'
(R):5'- CTGATTACCAGTGGACAGACC -3'
Posted On2019-05-15