Incidental Mutation 'R7073:Nr3c1'
ID549072
Institutional Source Beutler Lab
Gene Symbol Nr3c1
Ensembl Gene ENSMUSG00000024431
Gene Namenuclear receptor subfamily 3, group C, member 1
SynonymsGrl-1, GR, Grl1, glucocorticoid receptor
MMRRC Submission
Accession Numbers

Genbank: NM_008173

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7073 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location39410545-39491301 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39486396 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 279 (D279E)
Ref Sequence ENSEMBL: ENSMUSP00000095199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025300] [ENSMUST00000097592] [ENSMUST00000115567] [ENSMUST00000115571] [ENSMUST00000124115] [ENSMUST00000131885] [ENSMUST00000150483] [ENSMUST00000152853]
Predicted Effect probably benign
Transcript: ENSMUST00000025300
AA Change: D279E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000025300
Gene: ENSMUSG00000024431
AA Change: D279E

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000097592
AA Change: D279E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000095199
Gene: ENSMUSG00000024431
AA Change: D279E

DomainStartEndE-ValueType
Pfam:GCR 27 86 9.2e-16 PFAM
Pfam:GCR 75 418 1.4e-161 PFAM
ZnF_C4 434 506 8.6e-35 SMART
HOLI 581 745 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115567
AA Change: D279E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111229
Gene: ENSMUSG00000024431
AA Change: D279E

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115571
AA Change: D279E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000111233
Gene: ENSMUSG00000024431
AA Change: D279E

DomainStartEndE-ValueType
Pfam:GCR 27 418 1.4e-166 PFAM
ZnF_C4 434 505 7.6e-36 SMART
HOLI 580 744 8.8e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124115
SMART Domains Protein: ENSMUSP00000119630
Gene: ENSMUSG00000024431

DomainStartEndE-ValueType
Pfam:GCR 27 130 1e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131885
Predicted Effect probably benign
Transcript: ENSMUST00000150483
Predicted Effect probably benign
Transcript: ENSMUST00000152853
AA Change: D279E

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000120082
Gene: ENSMUSG00000024431
AA Change: D279E

DomainStartEndE-ValueType
Pfam:GCR 27 418 5.7e-167 PFAM
ZnF_C4 434 488 5.65e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes glucocorticoid receptor, which can function both as a transcription factor that binds to glucocorticoid response elements in the promoters of glucocorticoid responsive genes to activate their transcription, and as a regulator of other transcription factors. This receptor is typically found in the cytoplasm, but upon ligand binding, is transported into the nucleus. It is involved in inflammatory responses, cellular proliferation, and differentiation in target tissues. Mutations in this gene are associated with generalized glucocorticoid resistance. Alternative splicing of this gene results in transcript variants encoding either the same or different isoforms. Additional isoforms resulting from the use of alternate in-frame translation initiation sites have also been described, and shown to be functional, displaying diverse cytoplasm-to-nucleus trafficking patterns and distinct transcriptional activities (PMID:15866175). [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die at birth of respiratory failure with underdeveloped lungs, enlarged adrenals, elevated serum corticosterone and ACTH, and failed adrenaline synthesis. Mice with a point mutation have impaired gluconeogenesis and erythropoiesis. [provided by MGI curators]
Allele List at MGI

All alleles(12) : Targeted, knock-out(3) Targeted, other(8) Gene trapped(1)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrv1 T G 13: 81,561,474 E1133D probably damaging Het
Ankrd13b A T 11: 77,472,509 D505E probably benign Het
Ano1 C T 7: 144,638,552 E361K probably damaging Het
Arap3 T A 18: 37,974,442 K1341* probably null Het
Arhgef17 A C 7: 100,929,991 Y583* probably null Het
Ash1l G A 3: 88,985,340 E1509K probably damaging Het
B430305J03Rik T G 3: 61,364,260 R21S unknown Het
Bbof1 A G 12: 84,426,835 E313G probably damaging Het
Catsperb C T 12: 101,509,238 T347I probably benign Het
Ccdc24 G T 4: 117,872,004 A92D probably damaging Het
Ccdc63 T C 5: 122,111,010 T419A probably benign Het
Ccdc7a C T 8: 128,892,385 V893I possibly damaging Het
Ccdc88b G T 19: 6,853,962 D537E probably benign Het
Cd276 T C 9: 58,537,332 S119G probably damaging Het
Cdkn3 T C 14: 46,767,190 Y70H possibly damaging Het
Cdo1 G A 18: 46,728,199 probably benign Het
Cdr2 A T 7: 120,982,024 F10Y probably damaging Het
Cep290 A T 10: 100,539,003 K1370N possibly damaging Het
Crb1 T A 1: 139,248,311 I645F probably damaging Het
Cul7 T C 17: 46,658,731 W975R probably damaging Het
Ddx39b A C 17: 35,252,850 E324A probably benign Het
Diaph1 T G 18: 37,889,814 probably null Het
Dnah2 G A 11: 69,430,492 R3917* probably null Het
Dnph1 T A 17: 46,496,889 L27Q probably damaging Het
Duox2 A G 2: 122,289,307 F880S probably damaging Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Enpep A T 3: 129,312,670 Y302* probably null Het
Ergic2 G T 6: 148,195,209 H186Q probably damaging Het
Fam83b T C 9: 76,545,749 D12G probably benign Het
Fbxw16 A T 9: 109,441,055 V206D probably damaging Het
Fhod1 A T 8: 105,337,139 V278D unknown Het
Gba2 G C 4: 43,573,753 Q180E probably damaging Het
Gm11127 A T 17: 36,058,343 C7S unknown Het
Grhl3 G A 4: 135,573,412 L5F probably benign Het
Ifit1bl1 C T 19: 34,599,267 probably null Het
Ift57 A G 16: 49,763,867 T413A probably benign Het
Itga2 A G 13: 114,859,613 F714S probably damaging Het
Jmy A G 13: 93,441,333 S776P probably benign Het
Kbtbd8 G A 6: 95,121,833 A108T probably damaging Het
Kpna6 G A 4: 129,654,346 A230V probably damaging Het
Lrfn1 C T 7: 28,459,972 L439F possibly damaging Het
Lrrc1 T A 9: 77,468,565 I147F probably benign Het
Lrrc7 C T 3: 158,127,247 G1425R probably damaging Het
Madd T A 2: 91,162,509 I1022F probably damaging Het
Map2k2 A T 10: 81,106,183 T13S probably benign Het
Mdc1 G A 17: 35,854,068 V1459I probably benign Het
Mdh1b G A 1: 63,721,560 T114M probably damaging Het
Mfsd2a T C 4: 122,951,295 I208V possibly damaging Het
Mmrn1 T A 6: 60,988,427 D1147E probably damaging Het
Nbeal2 T A 9: 110,626,109 I2574F probably damaging Het
Nr1d1 T G 11: 98,772,066 S34R probably damaging Het
Nrde2 T C 12: 100,132,488 D640G probably benign Het
Odf4 A G 11: 68,926,688 L58P probably damaging Het
Olfr1184 A T 2: 88,487,307 I192F probably benign Het
Olfr1287 A T 2: 111,449,286 I49F probably benign Het
Otud6b A C 4: 14,811,743 M300R probably damaging Het
Pamr1 T A 2: 102,640,935 D534E probably benign Het
Pcdh7 T A 5: 57,720,957 V618E probably benign Het
Pcgf6 A C 19: 47,042,787 N266K possibly damaging Het
Plcz1 A T 6: 140,023,123 Y196* probably null Het
Plxna1 A T 6: 89,357,329 L106Q probably damaging Het
Qrich2 G A 11: 116,446,875 A184V probably damaging Het
Rimkla A G 4: 119,468,078 L378S probably benign Het
Rufy1 G T 11: 50,404,463 H472Q probably benign Het
Samd7 T A 3: 30,756,482 M216K probably benign Het
Samd9l A T 6: 3,375,856 Y468* probably null Het
Scn2a T G 2: 65,728,443 L1194R probably benign Het
Sgo2a T A 1: 58,017,785 S1043T possibly damaging Het
Slc6a17 G T 3: 107,471,439 H642Q probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
St6galnac3 T A 3: 153,411,637 T150S possibly damaging Het
Strip2 T A 6: 29,941,912 I627N possibly damaging Het
Sv2c A T 13: 96,088,250 C184S probably damaging Het
Tm7sf2 A T 19: 6,066,497 probably null Het
Ttc28 T C 5: 111,223,416 I608T possibly damaging Het
Vmn1r183 T G 7: 24,055,501 L243R probably damaging Het
Vmn1r68 T C 7: 10,527,851 T107A probably benign Het
Vnn3 G A 10: 23,864,413 G205R probably damaging Het
Zfp516 T A 18: 82,988,200 probably null Het
Zpbp2 A G 11: 98,552,509 D56G probably damaging Het
Other mutations in Nr3c1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Nr3c1 APN 18 39428608 splice site probably null
IGL00798:Nr3c1 APN 18 39486871 missense probably damaging 1.00
IGL01527:Nr3c1 APN 18 39486637 missense probably benign 0.00
IGL02088:Nr3c1 APN 18 39424391 missense probably damaging 1.00
IGL02244:Nr3c1 APN 18 39421557 unclassified probably benign
IGL03145:Nr3c1 APN 18 39486260 missense probably damaging 1.00
IGL03236:Nr3c1 APN 18 39486391 missense probably benign 0.00
3-1:Nr3c1 UTSW 18 39486039 missense probably benign
R1296:Nr3c1 UTSW 18 39486998 nonsense probably null
R2251:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2253:Nr3c1 UTSW 18 39486751 missense probably benign 0.38
R2922:Nr3c1 UTSW 18 39487103 missense possibly damaging 0.93
R4667:Nr3c1 UTSW 18 39428727 missense probably benign 0.22
R4971:Nr3c1 UTSW 18 39486877 missense probably damaging 1.00
R5106:Nr3c1 UTSW 18 39486601 missense possibly damaging 0.80
R5732:Nr3c1 UTSW 18 39415699 missense probably damaging 1.00
R5939:Nr3c1 UTSW 18 39420653 missense probably benign 0.26
R5976:Nr3c1 UTSW 18 39421549 missense probably damaging 1.00
R6091:Nr3c1 UTSW 18 39486958 small deletion probably benign
R6666:Nr3c1 UTSW 18 39487147 missense probably damaging 1.00
R7286:Nr3c1 UTSW 18 39486460 small insertion probably benign
R7289:Nr3c1 UTSW 18 39414601 missense probably benign 0.37
R7289:Nr3c1 UTSW 18 39422733 missense probably benign 0.03
R7334:Nr3c1 UTSW 18 39487037 missense probably benign 0.00
X0019:Nr3c1 UTSW 18 39487142 missense probably damaging 0.96
X0062:Nr3c1 UTSW 18 39428792 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCACGCCATGAACAGAAATGG -3'
(R):5'- CCTTTGACATCTTGCAGGATTTGG -3'

Sequencing Primer
(F):5'- CCATGAACAGAAATGGCAGAC -3'
(R):5'- GAGTTTTCTGCCGGGTCCC -3'
Posted On2019-05-15