Incidental Mutation 'R7074:Anapc1'
ID549081
Institutional Source Beutler Lab
Gene Symbol Anapc1
Ensembl Gene ENSMUSG00000014355
Gene Nameanaphase promoting complex subunit 1
Synonyms2610021O03Rik, tsg24, Apc1, Mcpr
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location128610104-128687391 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128678274 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 208 (P208T)
Ref Sequence ENSEMBL: ENSMUSP00000014499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014499] [ENSMUST00000110333]
Predicted Effect probably damaging
Transcript: ENSMUST00000014499
AA Change: P208T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014499
Gene: ENSMUSG00000014355
AA Change: P208T

DomainStartEndE-ValueType
Pfam:ANAPC1 150 214 1.7e-13 PFAM
low complexity region 323 345 N/A INTRINSIC
low complexity region 1404 1415 N/A INTRINSIC
Pfam:PC_rep 1467 1501 8.3e-8 PFAM
low complexity region 1516 1528 N/A INTRINSIC
low complexity region 1924 1936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110333
AA Change: P208T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105962
Gene: ENSMUSG00000014355
AA Change: P208T

DomainStartEndE-ValueType
Pfam:Apc1 149 227 1.7e-22 PFAM
low complexity region 323 345 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the anaphase-promoting complex. This complex is an E3 ubiquitin ligase that regulates progression through the metaphase to anaphase portion of the cell cycle by ubiquitinating proteins which targets them for degradation. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Anapc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Anapc1 APN 2 128645130 splice site probably benign
IGL00704:Anapc1 APN 2 128663984 missense possibly damaging 0.48
IGL01023:Anapc1 APN 2 128629729 missense probably damaging 1.00
IGL01432:Anapc1 APN 2 128633408 missense probably damaging 1.00
IGL01549:Anapc1 APN 2 128653170 missense probably benign
IGL02089:Anapc1 APN 2 128663933 missense probably damaging 1.00
IGL02275:Anapc1 APN 2 128659852 missense probably benign
IGL02570:Anapc1 APN 2 128645200 missense probably damaging 1.00
IGL02597:Anapc1 APN 2 128623931 missense probably benign 0.02
IGL02726:Anapc1 APN 2 128659785 missense probably benign 0.05
IGL03265:Anapc1 APN 2 128627197 missense probably damaging 1.00
IGL03304:Anapc1 APN 2 128627113 splice site probably benign
IGL03327:Anapc1 APN 2 128623934 missense probably benign 0.00
R0023:Anapc1 UTSW 2 128678218 missense probably damaging 0.99
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0027:Anapc1 UTSW 2 128641511 missense possibly damaging 0.96
R0084:Anapc1 UTSW 2 128623966 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0103:Anapc1 UTSW 2 128680452 splice site probably benign
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0109:Anapc1 UTSW 2 128634693 missense probably damaging 1.00
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0241:Anapc1 UTSW 2 128628629 missense possibly damaging 0.89
R0255:Anapc1 UTSW 2 128634711 missense probably damaging 0.99
R0377:Anapc1 UTSW 2 128641340 critical splice donor site probably null
R0467:Anapc1 UTSW 2 128669043 missense probably damaging 0.99
R0514:Anapc1 UTSW 2 128632655 missense probably damaging 0.99
R0591:Anapc1 UTSW 2 128619332 missense probably benign 0.17
R0919:Anapc1 UTSW 2 128617731 missense probably benign
R1175:Anapc1 UTSW 2 128680188 missense probably damaging 1.00
R1473:Anapc1 UTSW 2 128617697 missense possibly damaging 0.88
R1547:Anapc1 UTSW 2 128617556 missense probably benign 0.44
R1556:Anapc1 UTSW 2 128624899 missense probably benign 0.00
R1567:Anapc1 UTSW 2 128617716 missense probably damaging 1.00
R1635:Anapc1 UTSW 2 128628532 missense probably damaging 1.00
R1645:Anapc1 UTSW 2 128658246 critical splice donor site probably null
R1677:Anapc1 UTSW 2 128676208 missense probably benign 0.09
R1854:Anapc1 UTSW 2 128675890 missense probably damaging 1.00
R1856:Anapc1 UTSW 2 128659788 missense probably damaging 0.96
R1959:Anapc1 UTSW 2 128633415 missense probably benign 0.36
R1984:Anapc1 UTSW 2 128669688 missense possibly damaging 0.85
R2034:Anapc1 UTSW 2 128648458 missense possibly damaging 0.92
R2283:Anapc1 UTSW 2 128642548 missense probably benign 0.23
R2928:Anapc1 UTSW 2 128680137 missense probably damaging 1.00
R3547:Anapc1 UTSW 2 128642682 missense possibly damaging 0.58
R3904:Anapc1 UTSW 2 128642519 missense probably damaging 1.00
R4156:Anapc1 UTSW 2 128627229 intron probably benign
R4359:Anapc1 UTSW 2 128623556 missense possibly damaging 0.64
R4392:Anapc1 UTSW 2 128676249 critical splice acceptor site probably null
R4574:Anapc1 UTSW 2 128627195 missense probably damaging 1.00
R4682:Anapc1 UTSW 2 128664005 missense probably benign 0.05
R4770:Anapc1 UTSW 2 128686060 splice site probably benign
R4824:Anapc1 UTSW 2 128628690 missense possibly damaging 0.69
R4960:Anapc1 UTSW 2 128684594 missense probably benign 0.23
R5016:Anapc1 UTSW 2 128607175 unclassified probably benign
R5063:Anapc1 UTSW 2 128629549 missense possibly damaging 0.48
R5128:Anapc1 UTSW 2 128659917 missense probably benign
R5271:Anapc1 UTSW 2 128685985 nonsense probably null
R5363:Anapc1 UTSW 2 128650194 critical splice donor site probably null
R5469:Anapc1 UTSW 2 128675701 nonsense probably null
R5473:Anapc1 UTSW 2 128607195 unclassified probably benign
R5559:Anapc1 UTSW 2 128680434 nonsense probably null
R5631:Anapc1 UTSW 2 128657217 missense possibly damaging 0.85
R5747:Anapc1 UTSW 2 128624916 missense probably benign 0.19
R5840:Anapc1 UTSW 2 128607037 unclassified probably benign
R6226:Anapc1 UTSW 2 128650372 missense probably damaging 1.00
R6526:Anapc1 UTSW 2 128672135 nonsense probably null
R6561:Anapc1 UTSW 2 128663999 missense probably damaging 0.98
R6743:Anapc1 UTSW 2 128684534 nonsense probably null
R6799:Anapc1 UTSW 2 128659737 missense probably null 0.38
R6887:Anapc1 UTSW 2 128659768 missense possibly damaging 0.91
R6978:Anapc1 UTSW 2 128669900 missense probably benign 0.06
R7011:Anapc1 UTSW 2 128648681 intron probably null
R7041:Anapc1 UTSW 2 128628656 missense possibly damaging 0.88
R7047:Anapc1 UTSW 2 128615430 missense probably damaging 0.96
R7109:Anapc1 UTSW 2 128674602 missense probably benign 0.33
R7123:Anapc1 UTSW 2 128613010 missense probably damaging 1.00
R7309:Anapc1 UTSW 2 128674684 missense probably damaging 0.96
R7693:Anapc1 UTSW 2 128641537 missense possibly damaging 0.86
R7839:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7847:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R7922:Anapc1 UTSW 2 128684608 missense probably damaging 0.99
R7930:Anapc1 UTSW 2 128669908 missense possibly damaging 0.93
R8061:Anapc1 UTSW 2 128648488 missense probably damaging 0.98
R8127:Anapc1 UTSW 2 128632627 missense probably damaging 0.96
X0066:Anapc1 UTSW 2 128674701 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- CCTTGGCTTTGCTGAGATAAC -3'
(R):5'- GGCTCTGTACATCTTGGCAG -3'

Sequencing Primer
(F):5'- GCTGAGATAACTGTTGTTCTTGC -3'
(R):5'- AAGACCCTGTTTTCTCAAAGGC -3'
Posted On2019-05-15