Incidental Mutation 'R7074:Sel1l2'
ID549083
Institutional Source Beutler Lab
Gene Symbol Sel1l2
Ensembl Gene ENSMUSG00000074764
Gene Namesel-1 suppressor of lin-12-like 2 (C. elegans)
SynonymsLOC228684
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location140229855-140389706 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 140263442 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 276 (N276I)
Ref Sequence ENSEMBL: ENSMUSP00000113800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122367]
Predicted Effect probably damaging
Transcript: ENSMUST00000122367
AA Change: N276I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113800
Gene: ENSMUSG00000074764
AA Change: N276I

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 70 83 N/A INTRINSIC
SEL1 107 142 1.99e2 SMART
SEL1 143 178 3.3e1 SMART
SEL1 179 214 5.7e-1 SMART
SEL1 215 250 6.3e-3 SMART
SEL1 297 333 6.59e-6 SMART
SEL1 334 370 1.32e-5 SMART
SEL1 371 406 4.55e-9 SMART
SEL1 407 442 4.02e-10 SMART
SEL1 443 478 2.72e-7 SMART
Blast:SEL1 511 550 9e-13 BLAST
SEL1 551 586 1.01e-6 SMART
SEL1 588 623 4.55e-9 SMART
transmembrane domain 661 683 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Sel1l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00587:Sel1l2 APN 2 140243944 missense possibly damaging 0.95
IGL01782:Sel1l2 APN 2 140243935 missense probably damaging 1.00
IGL02238:Sel1l2 APN 2 140247939 missense probably damaging 1.00
IGL02506:Sel1l2 APN 2 140275460 missense possibly damaging 0.89
IGL02539:Sel1l2 APN 2 140230858 missense probably damaging 1.00
IGL02999:Sel1l2 APN 2 140230804 missense probably damaging 1.00
IGL03388:Sel1l2 APN 2 140263364 splice site probably benign
IGL02988:Sel1l2 UTSW 2 140248588 missense probably damaging 1.00
R0386:Sel1l2 UTSW 2 140275441 missense probably benign 0.11
R0426:Sel1l2 UTSW 2 140240912 nonsense probably null
R0549:Sel1l2 UTSW 2 140265882 missense probably damaging 0.99
R1404:Sel1l2 UTSW 2 140230059 splice site probably benign
R1502:Sel1l2 UTSW 2 140389595 missense probably damaging 0.99
R1746:Sel1l2 UTSW 2 140285237 missense probably damaging 0.98
R2187:Sel1l2 UTSW 2 140230873 missense probably damaging 1.00
R2233:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R2235:Sel1l2 UTSW 2 140244165 missense probably damaging 1.00
R3402:Sel1l2 UTSW 2 140241038 missense probably damaging 1.00
R4717:Sel1l2 UTSW 2 140230023 missense possibly damaging 0.89
R4724:Sel1l2 UTSW 2 140240927 missense probably damaging 0.99
R4840:Sel1l2 UTSW 2 140263470 missense probably benign 0.00
R4948:Sel1l2 UTSW 2 140244166 missense probably damaging 1.00
R6008:Sel1l2 UTSW 2 140244105 missense probably damaging 1.00
R6058:Sel1l2 UTSW 2 140240969 missense possibly damaging 0.94
R6389:Sel1l2 UTSW 2 140245354 missense probably damaging 1.00
R7031:Sel1l2 UTSW 2 140340123 missense possibly damaging 0.84
R7056:Sel1l2 UTSW 2 140245414 missense probably benign 0.13
R7213:Sel1l2 UTSW 2 140244135 missense probably damaging 1.00
R7348:Sel1l2 UTSW 2 140265724 missense probably benign
R8030:Sel1l2 UTSW 2 140241018 missense probably damaging 0.97
R8100:Sel1l2 UTSW 2 140275409 missense probably damaging 1.00
R8165:Sel1l2 UTSW 2 140262706 missense probably damaging 1.00
R8201:Sel1l2 UTSW 2 140266392 missense probably damaging 1.00
X0019:Sel1l2 UTSW 2 140248615 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCAAGGGAGGGCACTGTC -3'
(R):5'- AGCAAAGCTCTATTCCCATGGAG -3'

Sequencing Primer
(F):5'- GTCAATCCTTCTGGCACTTAGAAG -3'
(R):5'- GTCTAGATGCCTGCACAACTTAAG -3'
Posted On2019-05-15