Incidental Mutation 'R7074:Acss2'
ID549084
Institutional Source Beutler Lab
Gene Symbol Acss2
Ensembl Gene ENSMUSG00000027605
Gene Nameacyl-CoA synthetase short-chain family member 2
SynonymsAcas1, acetyl-CoA synthetase 1, Acas2, AceCS1, ACAS, Acs1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.379) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location155517948-155585724 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 155522041 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 80 (L80P)
Ref Sequence ENSEMBL: ENSMUSP00000029135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029135] [ENSMUST00000065973] [ENSMUST00000103142] [ENSMUST00000133654] [ENSMUST00000147601]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029135
AA Change: L80P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000029135
Gene: ENSMUSG00000027605
AA Change: L80P

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 1.9e-96 PFAM
Pfam:AMP-binding_C 583 661 2.4e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065973
AA Change: L80P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068776
Gene: ENSMUSG00000027605
AA Change: L80P

DomainStartEndE-ValueType
Pfam:AMP-binding 108 575 4.8e-98 PFAM
Pfam:AMP-binding_C 583 660 3.1e-21 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000103142
AA Change: L80P

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099431
Gene: ENSMUSG00000027605
AA Change: L80P

DomainStartEndE-ValueType
Pfam:ACAS_N 47 107 8.1e-21 PFAM
Pfam:AMP-binding 108 588 4.7e-97 PFAM
Pfam:AMP-binding_C 596 674 1.3e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000133654
AA Change: L80P

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect probably benign
Transcript: ENSMUST00000147601
SMART Domains Protein: ENSMUSP00000120560
Gene: ENSMUSG00000027603

DomainStartEndE-ValueType
low complexity region 28 42 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
transmembrane domain 109 131 N/A INTRINSIC
Pfam:G_glu_transpept 154 202 6.6e-18 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytosolic enzyme that catalyzes the activation of acetate for use in lipid synthesis and energy generation. The protein acts as a monomer and produces acetyl-CoA from acetate in a reaction that requires ATP. Expression of this gene is regulated by sterol regulatory element-binding proteins, transcription factors that activate genes required for the synthesis of cholesterol and unsaturated fatty acids. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Acss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01146:Acss2 APN 2 155562037 missense possibly damaging 0.83
IGL02333:Acss2 APN 2 155555884 missense probably damaging 1.00
IGL03278:Acss2 APN 2 155562001 missense possibly damaging 0.64
IGL03392:Acss2 APN 2 155562011 missense probably damaging 1.00
BB009:Acss2 UTSW 2 155573180 missense unknown
BB019:Acss2 UTSW 2 155573180 missense unknown
R1159:Acss2 UTSW 2 155551218 missense probably benign
R1293:Acss2 UTSW 2 155551221 missense probably benign
R1639:Acss2 UTSW 2 155556908 missense probably benign 0.01
R1725:Acss2 UTSW 2 155556844 missense possibly damaging 0.56
R1834:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1835:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R1836:Acss2 UTSW 2 155558630 missense probably damaging 1.00
R2361:Acss2 UTSW 2 155558669 missense probably damaging 0.98
R3899:Acss2 UTSW 2 155557237 splice site probably benign
R4008:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4009:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4010:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4011:Acss2 UTSW 2 155557628 missense probably damaging 1.00
R4031:Acss2 UTSW 2 155557210 missense probably damaging 1.00
R4117:Acss2 UTSW 2 155556393 missense probably damaging 1.00
R4515:Acss2 UTSW 2 155556363 missense probably benign 0.39
R4756:Acss2 UTSW 2 155561143 missense probably damaging 1.00
R4895:Acss2 UTSW 2 155550481 splice site probably benign
R5327:Acss2 UTSW 2 155573229 missense probably null
R5654:Acss2 UTSW 2 155574655 unclassified probably benign
R5717:Acss2 UTSW 2 155561153 missense probably damaging 1.00
R5743:Acss2 UTSW 2 155574616 unclassified probably benign
R5773:Acss2 UTSW 2 155574694 splice site probably null
R5825:Acss2 UTSW 2 155549178 unclassified probably null
R5979:Acss2 UTSW 2 155522109 missense possibly damaging 0.75
R6525:Acss2 UTSW 2 155550417 missense probably benign
R6551:Acss2 UTSW 2 155551208 missense probably benign
R6785:Acss2 UTSW 2 155560685 missense probably damaging 1.00
R6976:Acss2 UTSW 2 155556009 intron probably null
R7372:Acss2 UTSW 2 155557180 missense probably damaging 0.99
R7448:Acss2 UTSW 2 155518266 missense probably damaging 1.00
R7528:Acss2 UTSW 2 155557146 missense probably damaging 1.00
R7541:Acss2 UTSW 2 155574690 critical splice donor site probably null
R7543:Acss2 UTSW 2 155549835 missense probably damaging 0.98
R7754:Acss2 UTSW 2 155561166 missense probably benign 0.00
R7846:Acss2 UTSW 2 155561033 missense probably damaging 1.00
R7932:Acss2 UTSW 2 155573180 missense unknown
R8011:Acss2 UTSW 2 155555957 missense possibly damaging 0.73
Z1177:Acss2 UTSW 2 155517957 intron probably benign
Predicted Primers PCR Primer
(F):5'- CATTTGGGAATAGCCTGTAGGTGC -3'
(R):5'- GAGATTGTTCTCTGCCATAGACT -3'

Sequencing Primer
(F):5'- CTAGGGTCGACAAATAATGAGTCC -3'
(R):5'- GCACGTTGTAGCAGATGT -3'
Posted On2019-05-15