Incidental Mutation 'R7074:Mttp'
ID549087
Institutional Source Beutler Lab
Gene Symbol Mttp
Ensembl Gene ENSMUSG00000028158
Gene Namemicrosomal triglyceride transfer protein
Synonyms1810043K16Rik, MTP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.848) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome3
Chromosomal Location138089854-138144968 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 138107273 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 532 (R532L)
Ref Sequence ENSEMBL: ENSMUSP00000029805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029805] [ENSMUST00000098580]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029805
AA Change: R532L

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029805
Gene: ENSMUSG00000028158
AA Change: R532L

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LPD_N 28 579 8.87e-165 SMART
Blast:LPD_N 582 695 4e-58 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000098580
AA Change: R547L

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096179
Gene: ENSMUSG00000028158
AA Change: R547L

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
LPD_N 43 594 8.87e-165 SMART
Blast:LPD_N 597 710 6e-58 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MTP encodes the large subunit of the heterodimeric microsomal triglyceride transfer protein. Protein disulfide isomerase (PDI) completes the heterodimeric microsomal triglyceride transfer protein, which has been shown to play a central role in lipoprotein assembly. Mutations in MTP can cause abetalipoproteinemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most embryos homozygous for a reporter allele die at midgestation displaying delayed growth, neurodevelopmental anomalies, impaired erythropoiesis, deficient yolk sac lipoprotein production, hemorrhage and necrosis. Heterozygous mutant mice display altered plasma lipid and lipoprotein profiles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Mttp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Mttp APN 3 138109015 missense possibly damaging 0.84
IGL00983:Mttp APN 3 138115129 splice site probably benign
IGL01128:Mttp APN 3 138133997 splice site probably null
IGL01607:Mttp APN 3 138104698 missense probably damaging 0.99
IGL01760:Mttp APN 3 138111736 missense probably benign 0.00
IGL01947:Mttp APN 3 138107129 missense probably damaging 1.00
IGL02184:Mttp APN 3 138116000 critical splice donor site probably null
IGL02932:Mttp APN 3 138111744 missense probably benign 0.07
IGL02957:Mttp APN 3 138109081 missense possibly damaging 0.95
IGL03082:Mttp APN 3 138123795 missense probably benign 0.01
IGL03302:Mttp APN 3 138104707 missense possibly damaging 0.90
IGL03381:Mttp APN 3 138104943 missense probably damaging 1.00
P0040:Mttp UTSW 3 138112566 missense possibly damaging 0.82
R0543:Mttp UTSW 3 138111696 missense possibly damaging 0.75
R0738:Mttp UTSW 3 138103313 missense probably damaging 1.00
R0967:Mttp UTSW 3 138092723 missense probably benign 0.00
R1281:Mttp UTSW 3 138107219 missense possibly damaging 0.95
R1565:Mttp UTSW 3 138116405 critical splice donor site probably null
R1660:Mttp UTSW 3 138103193 missense probably damaging 1.00
R1828:Mttp UTSW 3 138107280 missense probably damaging 1.00
R1886:Mttp UTSW 3 138092615 missense probably damaging 1.00
R1912:Mttp UTSW 3 138116027 missense probably benign 0.01
R1938:Mttp UTSW 3 138125121 missense probably benign 0.21
R2020:Mttp UTSW 3 138118402 missense probably damaging 0.98
R2109:Mttp UTSW 3 138095002 missense probably benign 0.27
R2336:Mttp UTSW 3 138116095 missense possibly damaging 0.81
R2392:Mttp UTSW 3 138095021 missense probably damaging 0.98
R3021:Mttp UTSW 3 138111703 missense probably benign
R3774:Mttp UTSW 3 138114263 intron probably null
R3776:Mttp UTSW 3 138114263 intron probably null
R4687:Mttp UTSW 3 138092735 missense possibly damaging 0.66
R4708:Mttp UTSW 3 138134098 unclassified probably benign
R4756:Mttp UTSW 3 138116071 missense possibly damaging 0.77
R4832:Mttp UTSW 3 138116050 missense probably benign
R5377:Mttp UTSW 3 138105029 missense probably benign 0.03
R5670:Mttp UTSW 3 138125113 missense probably damaging 0.99
R6613:Mttp UTSW 3 138109078 missense probably damaging 1.00
R6725:Mttp UTSW 3 138107238 missense probably damaging 1.00
R6799:Mttp UTSW 3 138095080 missense probably benign 0.04
R6920:Mttp UTSW 3 138115282 missense possibly damaging 0.49
R7131:Mttp UTSW 3 138116132 missense probably benign 0.13
R7275:Mttp UTSW 3 138123785 missense probably benign 0.19
R7291:Mttp UTSW 3 138091203 missense probably damaging 1.00
R7310:Mttp UTSW 3 138095022 missense probably damaging 1.00
R7769:Mttp UTSW 3 138103112 missense probably damaging 1.00
R7909:Mttp UTSW 3 138118417 nonsense probably null
R7990:Mttp UTSW 3 138118417 nonsense probably null
R8037:Mttp UTSW 3 138091122 missense probably damaging 1.00
Z1176:Mttp UTSW 3 138104779 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGCGTGGAATGCATTGTAC -3'
(R):5'- TCAGAGAGCAACCTTTTGTACTC -3'

Sequencing Primer
(F):5'- AATGCATTGTACCTTGCAGGC -3'
(R):5'- GAGAGCAACCTTTTGTACTCTCTCC -3'
Posted On2019-05-15