Mutagenetix > Incidental Mutations

Incidental Mutation 'R0613:Cntnap3'

54909

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

038802-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.061) question?

Stock #

R0613 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 64758414 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Isoleucine at position 793 (F793I)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: F793I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: F793I

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.0842

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.3%

Validation Efficiency

100% (72/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acd	A	T	8: 105,700,568		probably null	Het
Adcy9	A	G	16: 4,419,539	S3P	probably damaging	Het
Adgrl4	T	C	3: 151,543,222		probably benign	Het
Aff3	T	C	1: 38,209,923	E700G	probably benign	Het
Ahctf1	A	G	1: 179,769,414	S56P	probably damaging	Het
Atp12a	T	A	14: 56,374,521	I384N	probably damaging	Het
Brca1	A	T	11: 101,508,210	S1519T	probably benign	Het
Ccl25	T	C	8: 4,349,850	V94A	probably benign	Het
Cep170	T	C	1: 176,774,680	T287A	probably benign	Het
Ces1a	A	G	8: 93,025,581	S383P	probably benign	Het
Ctsm	T	C	13: 61,539,682	R89G	probably damaging	Het
Cyp2j12	T	G	4: 96,102,079	T417P	probably damaging	Het
D430041D05Rik	G	C	2: 104,167,950	P1836R	probably damaging	Het
Edn2	T	A	4: 120,161,864		probably null	Het
Emc1	T	A	4: 139,375,072		probably benign	Het
Fam189a2	T	A	19: 23,986,489	N239Y	probably damaging	Het
Fras1	T	C	5: 96,700,488		probably benign	Het
Fsip2	A	T	2: 82,993,795	D6624V	probably damaging	Het
Gpr107	A	G	2: 31,178,285	Y253C	probably damaging	Het
Gpr108	A	G	17: 57,238,174		probably benign	Het
Grik1	A	G	16: 88,051,333		probably null	Het
Gtf3c1	G	A	7: 125,644,134	P1766L	possibly damaging	Het
Gucy2c	A	T	6: 136,760,723	N293K	probably damaging	Het
Hps6	C	A	19: 46,003,821	P66T	probably benign	Het
Hspa9	A	T	18: 34,947,980	V216E	probably damaging	Het
Igsf8	T	A	1: 172,317,589	M224K	probably benign	Het
Igsf9b	T	C	9: 27,326,920	V569A	probably damaging	Het
Itgb4	A	T	11: 115,993,342	I952F	probably damaging	Het
Kcnh4	C	T	11: 100,746,932	G633E	probably benign	Het
Khdrbs2	A	G	1: 32,657,522	H344R	possibly damaging	Het
Kmo	C	A	1: 175,637,892	R71S	probably damaging	Het
Lrrc31	A	G	3: 30,685,035		probably benign	Het
Map1b	T	A	13: 99,441,641	D168V	probably damaging	Het
Mfsd6	T	C	1: 52,658,696		probably benign	Het
Mgst1	G	A	6: 138,156,245	G186D	probably damaging	Het
Mrc1	C	T	2: 14,294,819	A740V	probably damaging	Het
Mroh2a	G	A	1: 88,243,950	R770Q	probably damaging	Het
Mtor	T	C	4: 148,526,046	Y1605H	possibly damaging	Het
Ncoa4	T	A	14: 32,176,552	L443Q	probably damaging	Het
Nelfa	G	A	5: 33,903,463		probably benign	Het
Nepn	T	A	10: 52,401,257	L363Q	probably damaging	Het
Nfat5	A	G	8: 107,366,295	T630A	possibly damaging	Het
Nipal4	A	T	11: 46,150,384	V328E	probably benign	Het
Olfr1228	A	T	2: 89,249,125	C178S	probably damaging	Het
Olfr1391	T	A	11: 49,327,748	S112R	possibly damaging	Het
Olfr462	A	T	11: 87,889,227	V223E	possibly damaging	Het
Olfr747	T	A	14: 50,681,404	I77F	probably benign	Het
Olfr809	T	A	10: 129,776,262	M116K	probably damaging	Het
Olfr924	T	A	9: 38,848,613	C166*	probably null	Het
Otogl	A	T	10: 107,817,070	N1140K	probably damaging	Het
Ppip5k2	A	C	1: 97,752,740	Y236*	probably null	Het
Prelid1	C	T	13: 55,324,343	R111*	probably null	Het
Prpf8	T	C	11: 75,503,444	L1771P	probably damaging	Het
Ptprb	A	T	10: 116,302,325	Y378F	possibly damaging	Het
Ptprb	A	G	10: 116,302,378	T396A	possibly damaging	Het
Rab3il1	T	C	19: 10,028,364	L174P	probably damaging	Het
Rab4a	T	C	8: 123,823,835	V18A	possibly damaging	Het
Scn3a	T	A	2: 65,472,284	M1273L	possibly damaging	Het
Sdhc	A	T	1: 171,129,844	V156E	probably benign	Het
Slco3a1	T	C	7: 74,346,634		probably benign	Het
Syne3	T	C	12: 104,958,112	T343A	probably benign	Het
Syt11	A	G	3: 88,762,469	C39R	probably damaging	Het
Tll2	G	T	19: 41,104,990	D462E	probably damaging	Het
Tmem132e	T	A	11: 82,438,338	V481D	probably damaging	Het
Tmem161b	C	T	13: 84,251,320	L17F	probably damaging	Het
Vmn2r105	T	A	17: 20,208,316	I833F	probably damaging	Het
Vstm2a	A	T	11: 16,263,140	N175I	probably damaging	Het
Xpnpep1	G	T	19: 53,006,353	D238E	probably damaging	Het
Zfp112	G	A	7: 24,127,028	G807D	probably benign	Het
Zfp518b	A	T	5: 38,673,603	V353E	probably damaging	Het
Zfp69	T	C	4: 120,934,347	E39G	probably benign	Het
Zfp865	A	G	7: 5,029,091	H25R	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4384:Cntnap3	UTSW	13	64748460	missense	probably damaging	1.00
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GATGAAGTCAGTGATTCCCAGGTTCTC -3'
(R):5'- TCACAACATGTACAAGAAGCATGTAGCA -3'

Sequencing Primer
(F):5'- ATTCCCAGGTTCTCCATGAACAC -3'
(R):5'- tgtgtgtgtgtgtgtTTATGATG -3'

Posted On

2013-07-11