Incidental Mutation 'R7074:Grip2'
ID549098
Institutional Source Beutler Lab
Gene Symbol Grip2
Ensembl Gene ENSMUSG00000030098
Gene Nameglutamate receptor interacting protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location91761509-91827250 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 91784708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 235 (V235E)
Ref Sequence ENSEMBL: ENSMUSP00000124709 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159684] [ENSMUST00000161566] [ENSMUST00000162293] [ENSMUST00000162300]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159684
AA Change: V235E

PolyPhen 2 Score 0.885 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000125047
Gene: ENSMUSG00000030098
AA Change: V235E

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 385 390 N/A INTRINSIC
PDZ 426 506 2.18e-15 SMART
PDZ 527 602 3.86e-16 SMART
PDZ 625 699 1.38e-17 SMART
low complexity region 778 793 N/A INTRINSIC
low complexity region 867 878 N/A INTRINSIC
PDZ 910 982 2.95e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161545
SMART Domains Protein: ENSMUSP00000125538
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
PDB:2QT5|B 42 89 3e-9 PDB
SCOP:d1lcya1 47 89 2e-7 SMART
low complexity region 103 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161566
SMART Domains Protein: ENSMUSP00000123941
Gene: ENSMUSG00000030098

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 9.96e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000162293
AA Change: V183E

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000124717
Gene: ENSMUSG00000030098
AA Change: V183E

DomainStartEndE-ValueType
PDZ 10 84 1.12e-12 SMART
PDZ 109 187 3.8e-15 SMART
PDZ 210 285 7.9e-13 SMART
low complexity region 336 348 N/A INTRINSIC
low complexity region 374 379 N/A INTRINSIC
PDZ 415 495 2.18e-15 SMART
PDZ 516 591 3.86e-16 SMART
PDZ 614 688 1.38e-17 SMART
low complexity region 767 782 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162300
AA Change: V235E

PolyPhen 2 Score 0.239 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000124709
Gene: ENSMUSG00000030098
AA Change: V235E

DomainStartEndE-ValueType
low complexity region 25 36 N/A INTRINSIC
PDZ 62 136 1.12e-12 SMART
PDZ 161 239 3.8e-15 SMART
PDZ 262 337 7.9e-13 SMART
low complexity region 388 400 N/A INTRINSIC
low complexity region 426 431 N/A INTRINSIC
PDZ 467 547 2.18e-15 SMART
PDZ 568 643 3.86e-16 SMART
PDZ 666 740 1.38e-17 SMART
low complexity region 819 834 N/A INTRINSIC
low complexity region 908 919 N/A INTRINSIC
PDZ 951 1023 2.95e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice are born in numbers expected by the Mendelian ratio and show no overt phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Grip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Grip2 APN 6 91782897 missense probably benign 0.00
IGL01748:Grip2 APN 6 91764743 missense probably damaging 1.00
IGL01838:Grip2 APN 6 91764763 missense possibly damaging 0.92
IGL02392:Grip2 APN 6 91787295 missense probably damaging 1.00
IGL02620:Grip2 APN 6 91778606 missense possibly damaging 0.93
IGL02862:Grip2 APN 6 91788104 missense probably damaging 0.98
IGL03027:Grip2 APN 6 91778871 missense probably benign 0.02
IGL03180:Grip2 APN 6 91785761 splice site probably benign
R0265:Grip2 UTSW 6 91773792 critical splice donor site probably null
R0448:Grip2 UTSW 6 91779213 missense probably damaging 1.00
R0597:Grip2 UTSW 6 91796197 intron probably benign
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1405:Grip2 UTSW 6 91788152 splice site probably null
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1466:Grip2 UTSW 6 91788443 missense probably damaging 0.98
R1664:Grip2 UTSW 6 91765252 missense probably damaging 1.00
R1703:Grip2 UTSW 6 91777398 missense probably damaging 1.00
R1793:Grip2 UTSW 6 91783642 missense probably benign 0.03
R1951:Grip2 UTSW 6 91783848 missense probably damaging 1.00
R2001:Grip2 UTSW 6 91779850 missense probably benign 0.00
R4730:Grip2 UTSW 6 91785712 makesense probably null
R4754:Grip2 UTSW 6 91779182 missense probably damaging 1.00
R4754:Grip2 UTSW 6 91779192 missense probably damaging 0.97
R4773:Grip2 UTSW 6 91782432 missense possibly damaging 0.80
R5135:Grip2 UTSW 6 91773916 missense possibly damaging 0.89
R5213:Grip2 UTSW 6 91779831 missense probably benign 0.04
R5972:Grip2 UTSW 6 91807281 missense probably benign 0.01
R6176:Grip2 UTSW 6 91779851 missense probably benign 0.00
R6188:Grip2 UTSW 6 91763533 missense probably damaging 1.00
R6289:Grip2 UTSW 6 91778871 missense probably benign 0.02
R6345:Grip2 UTSW 6 91765388 missense possibly damaging 0.91
R6348:Grip2 UTSW 6 91780438 missense probably damaging 0.99
R6394:Grip2 UTSW 6 91787201 missense probably damaging 1.00
R6658:Grip2 UTSW 6 91786491 missense probably damaging 1.00
R7065:Grip2 UTSW 6 91783569 critical splice donor site probably null
R7308:Grip2 UTSW 6 91778688 missense possibly damaging 0.74
R7607:Grip2 UTSW 6 91788412 missense probably benign
R7617:Grip2 UTSW 6 91765050 intron probably null
R8221:Grip2 UTSW 6 91785684 missense possibly damaging 0.90
RF003:Grip2 UTSW 6 91783593 missense probably benign 0.02
Z1176:Grip2 UTSW 6 91763510 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCCTGACCCCTAGTGATATCAG -3'
(R):5'- AGCTCAGATATGCTGTGGGTAG -3'

Sequencing Primer
(F):5'- CCTGACCCCTAGTGATATCAGGAGAG -3'
(R):5'- GCATCAGAGTTGGCCTTTTAC -3'
Posted On2019-05-15