Incidental Mutation 'R7074:Dixdc1'
ID549106
Institutional Source Beutler Lab
Gene Symbol Dixdc1
Ensembl Gene ENSMUSG00000032064
Gene NameDIX domain containing 1
Synonyms4930563F16Rik, Ccd1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location50662752-50739517 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 50689914 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 344 (E344D)
Ref Sequence ENSEMBL: ENSMUSP00000034566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034566] [ENSMUST00000117646] [ENSMUST00000120622] [ENSMUST00000121634]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034566
AA Change: E344D

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034566
Gene: ENSMUSG00000032064
AA Change: E344D

DomainStartEndE-ValueType
CH 22 151 5.48e-8 SMART
low complexity region 178 190 N/A INTRINSIC
low complexity region 237 254 N/A INTRINSIC
coiled coil region 306 338 N/A INTRINSIC
coiled coil region 359 492 N/A INTRINSIC
Pfam:DIX 627 706 1.1e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117646
AA Change: E318D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112431
Gene: ENSMUSG00000032064
AA Change: E318D

DomainStartEndE-ValueType
CH 22 125 1.25e-11 SMART
low complexity region 152 164 N/A INTRINSIC
low complexity region 211 228 N/A INTRINSIC
coiled coil region 280 312 N/A INTRINSIC
coiled coil region 333 466 N/A INTRINSIC
Pfam:DIX 600 682 5.1e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120622
AA Change: E72D

PolyPhen 2 Score 0.748 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113934
Gene: ENSMUSG00000032064
AA Change: E72D

DomainStartEndE-ValueType
coiled coil region 34 66 N/A INTRINSIC
coiled coil region 87 220 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121634
AA Change: E343D

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000113089
Gene: ENSMUSG00000032064
AA Change: E343D

DomainStartEndE-ValueType
CH 21 150 5.48e-8 SMART
low complexity region 177 189 N/A INTRINSIC
low complexity region 236 253 N/A INTRINSIC
coiled coil region 305 337 N/A INTRINSIC
coiled coil region 358 491 N/A INTRINSIC
Pfam:DIX 625 707 5.3e-37 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a positive regulator of the Wnt signaling pathway. The encoded protein is found associated with gamma tubulin at the centrosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced spontaneous locomotor activity, abnormal behavior in the elevated plus maze, and deficits in startle reactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cpd T A 11: 76,813,594 N398I probably damaging Het
Cplx1 C T 5: 108,548,527 probably null Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Dixdc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00923:Dixdc1 APN 9 50667733 missense probably damaging 0.98
IGL01556:Dixdc1 APN 9 50706134 missense probably damaging 1.00
IGL01923:Dixdc1 APN 9 50695503 missense possibly damaging 0.87
IGL01933:Dixdc1 APN 9 50703258 nonsense probably null
IGL02074:Dixdc1 APN 9 50702017 missense probably benign 0.00
IGL02364:Dixdc1 APN 9 50682631 splice site probably benign
R0230:Dixdc1 UTSW 9 50695507 missense possibly damaging 0.80
R0401:Dixdc1 UTSW 9 50693674 missense possibly damaging 0.54
R0410:Dixdc1 UTSW 9 50684853 missense probably damaging 1.00
R1028:Dixdc1 UTSW 9 50703246 missense probably benign 0.02
R1083:Dixdc1 UTSW 9 50676993 intron probably benign
R1672:Dixdc1 UTSW 9 50689864 missense probably damaging 1.00
R1752:Dixdc1 UTSW 9 50682550 missense probably benign
R2213:Dixdc1 UTSW 9 50701945 missense probably benign 0.01
R2289:Dixdc1 UTSW 9 50683872 critical splice donor site probably null
R2939:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R2940:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R3081:Dixdc1 UTSW 9 50710959 missense probably damaging 0.98
R4982:Dixdc1 UTSW 9 50682602 missense possibly damaging 0.89
R5250:Dixdc1 UTSW 9 50683735 missense possibly damaging 0.88
R5581:Dixdc1 UTSW 9 50669480 missense probably damaging 1.00
R5914:Dixdc1 UTSW 9 50698588 intron probably benign
R6228:Dixdc1 UTSW 9 50703356 splice site probably null
R6346:Dixdc1 UTSW 9 50683953 missense probably damaging 1.00
R6370:Dixdc1 UTSW 9 50682223 intron probably null
R7036:Dixdc1 UTSW 9 50682564 missense probably benign 0.03
R7361:Dixdc1 UTSW 9 50688653 missense probably damaging 0.99
R7734:Dixdc1 UTSW 9 50701968 missense probably damaging 1.00
RF016:Dixdc1 UTSW 9 50693641 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTGCTGACTACATCAATGGG -3'
(R):5'- CTCTAGAAGGAGATGTGTGTCC -3'

Sequencing Primer
(F):5'- CTGACTACATCAATGGGGAAGCC -3'
(R):5'- TCCTCAGGGCCATTGGAAGTAG -3'
Posted On2019-05-15