Incidental Mutation 'R7074:Cpd'
ID549109
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Namecarboxypeptidase D
SynonymsD830034L15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock #R7074 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location76778424-76847018 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76813594 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 398 (N398I)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
Predicted Effect probably damaging
Transcript: ENSMUST00000021201
AA Change: N398I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: N398I

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4 A T 4: 144,613,863 I53L probably benign Het
Acss2 T C 2: 155,522,041 L80P possibly damaging Het
Adam3 A T 8: 24,694,347 F546I probably benign Het
Adtrp A T 13: 41,828,141 probably null Het
Anapc1 G T 2: 128,678,274 P208T probably damaging Het
Ankrd33 A G 15: 101,119,549 K281R probably benign Het
Bcl11b A G 12: 107,989,507 S128P probably benign Het
Ccdc57 T C 11: 120,903,374 K265E possibly damaging Het
Cep72 A G 13: 74,051,580 C244R probably benign Het
Cope A G 8: 70,312,887 Q303R probably benign Het
Cplx1 C T 5: 108,548,527 probably null Het
Dixdc1 T A 9: 50,689,914 E344D possibly damaging Het
Dock7 A T 4: 98,945,208 F1951I unknown Het
Ell2 C A 13: 75,761,887 L119M probably damaging Het
Faap24 A T 7: 35,395,102 I91K possibly damaging Het
Fubp3 T C 2: 31,595,294 S107P probably damaging Het
Gas2l2 T A 11: 83,423,067 Q473L probably benign Het
Ghr A T 15: 3,333,391 Y200N probably damaging Het
Gm4950 G A 18: 51,865,449 Q145* probably null Het
Gm826 C T 2: 160,311,890 V78I unknown Het
Gnas G A 2: 174,285,049 E126K probably damaging Het
Grip2 A T 6: 91,784,708 V235E probably benign Het
Hmgcl A G 4: 135,953,867 H88R probably benign Het
Htr7 A G 19: 36,056,883 V124A probably damaging Het
Igf2r T A 17: 12,714,116 I840F possibly damaging Het
Ints8 T C 4: 11,204,574 I961V possibly damaging Het
Jmy A T 13: 93,453,931 S555T probably benign Het
Klk1b27 G A 7: 44,056,553 G227S probably damaging Het
Lao1 A C 4: 118,968,185 T401P probably damaging Het
Lrwd1 C T 5: 136,123,657 V547I probably benign Het
Mttp C A 3: 138,107,273 R532L possibly damaging Het
Muc16 T C 9: 18,655,650 T1858A unknown Het
Myo18a T A 11: 77,842,561 D1409E probably benign Het
Ncor2 T A 5: 125,049,366 R554* probably null Het
Olfr127 T A 17: 37,903,827 Y94N possibly damaging Het
Olfr168 T A 16: 19,530,105 I272F possibly damaging Het
Olfr222 T C 11: 59,571,009 T244A probably damaging Het
Olfr22-ps1 A T 11: 73,955,149 H153L probably benign Het
Olfr690 A G 7: 105,329,268 M308T probably benign Het
Prkar2b A G 12: 31,972,148 Y213H probably damaging Het
Prkd3 T A 17: 78,974,807 K306* probably null Het
Psd2 A G 18: 36,010,684 E681G probably benign Het
Sel1l2 T A 2: 140,263,442 N276I probably damaging Het
Smox C T 2: 131,522,111 A45V possibly damaging Het
Smyd1 A G 6: 71,237,375 V214A probably damaging Het
Spag5 T C 11: 78,305,042 probably null Het
Trem3 C T 17: 48,249,881 R127W probably damaging Het
Ttn G A 2: 76,918,081 T4208I probably benign Het
Tubgcp6 A G 15: 89,120,636 F260S probably damaging Het
Vmn1r51 A T 6: 90,129,672 D190V probably benign Het
Zc3h14 A G 12: 98,758,600 I174V possibly damaging Het
Zfp423 G A 8: 87,782,432 T428I probably benign Het
Zfp608 T A 18: 54,897,382 N1162I possibly damaging Het
Zmym5 T C 14: 56,804,798 M8V probably benign Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4369:Cpd UTSW 11 76797711 missense possibly damaging 0.82
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGACAATCCTACATCTAAAGAGAGGC -3'
(R):5'- GTCTATACTTTGTTTCAACTTCAAGGG -3'

Sequencing Primer
(F):5'- TCCTACATCTAAAGAGAGGCTTGGC -3'
(R):5'- TTCCATAAAGGGTTCCAGGGC -3'
Posted On2019-05-15